CRISPR

CRISPR1-cd59a

ID

ZDB-CRISPR-230203-7

Name

CRISPR1-cd59a

Previous Names

CRISPR1-cd59

Target

cd59a (1)

Sequence

5' - GTGCTGGCTCTGCTGGGGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uva47	cd59a
uva48	cd59a

Expression

Gene expression in Wild Types + CRISPR1-cd59a

No data available

Phenotype

Phenotype resulting from CRISPR1-cd59a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cd59a

Phenotype	Fish	Conditions	Figures
posterior lateral line nerve has extra parts of type posterior lateral line immature Schwann cell, abnormal	cd59a^uva48/uva48	standard conditions	Fig. 4 from Wiltbank et al., 2022
posterior lateral line nerve has number of posterior lateral line myelinating Schwann cell, ameliorated	cd59a^uva48/uva48	chemical treatment by environment: dexamethasone	Fig. 7 from Wiltbank et al., 2022
posterior lateral line nerve has extra parts of type posterior lateral line myelinating Schwann cell, abnormal	cd59a^uva48/uva48	standard conditions	Fig. 4 , Fig. 7 from Wiltbank et al., 2022
posterior lateral line nerve nerve development decreased process quality, abnormal	cd59a^uva48/uva48	standard conditions	Fig. 5 from Wiltbank et al., 2022
posterior lateral line nerve myelinating Schwann cell cd59a expression decreased amount, abnormal	cd59a^uva48/uva48; sl3Tg	standard conditions	Fig. 3 from Wiltbank et al., 2022
myelinating Schwann cell activation of membrane attack complex increased process quality, abnormal	cd59a^uva48/uva48; sl3Tg	standard conditions	Fig. 6 from Wiltbank et al., 2022
posterior lateral line nerve Schwann cell proliferation increased occurrence, abnormal	cd59a^uva48/uva48; uva5Tg	standard conditions	Fig. 4 from Wiltbank et al., 2022
posterior lateral line nerve axon ab1-scn labeling spatial pattern, abnormal	cd59a^uva48/uva48; uva53Tg	control	Fig. 5 , Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve node of Ranvier ab1-nfasc labeling spatial pattern, abnormal	cd59a^uva48/uva48; uva53Tg	standard conditions	Fig. 5 from Wiltbank et al., 2022
posterior lateral line nerve axon ab1-scn labeling spatial pattern, ameliorated	cd59a^uva48/uva48; uva53Tg	chemical treatment by environment: dexamethasone	Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve nerve development process quality, ameliorated	cd59a^uva48/uva48; uva53Tg	chemical treatment by environment: dexamethasone	Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve clustering of voltage-gated sodium channels decreased process quality, abnormal	cd59a^uva48/uva48; uva53Tg	standard conditions	Fig. 5 , Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve node of Ranvier ab1-scn labeling spatial pattern, ameliorated	cd59a^uva48/uva48; uva53Tg	chemical treatment by environment: dexamethasone	Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve axon ab1-nfasc labeling spatial pattern, abnormal	cd59a^uva48/uva48; uva53Tg	standard conditions	Fig. 5 from Wiltbank et al., 2022
posterior lateral line nerve nerve development decreased process quality, abnormal	cd59a^uva48/uva48; uva53Tg	standard conditions	Fig. 5 , Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve node of Ranvier ab1-scn labeling spatial pattern, abnormal	cd59a^uva48/uva48; uva53Tg	control	Fig. 5 , Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve clustering of voltage-gated sodium channels process quality, ameliorated	cd59a^uva48/uva48; uva53Tg	chemical treatment by environment: dexamethasone	Fig. 8 from Wiltbank et al., 2022
posterior lateral line nerve Schwann cell proliferation occurrence, ameliorated	cd59a^uva48/uva48; w18Tg	chemical treatment by environment: dexamethasone	Fig. 7 from Wiltbank et al., 2022
posterior lateral line nerve Schwann cell proliferation increased occurrence, abnormal	cd59a^uva48/uva48; w18Tg	control	Fig. 7 from Wiltbank et al., 2022

Citations