CRISPR

CRISPR5-mafbb

ID
ZDB-CRISPR-230131-10
Name
CRISPR5-mafbb
Previous Names
None
Target
Sequence
5' - GGCGAGCCTGGCGACGCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hkz56 mafbb
uq47bh mafbb
Expression
Gene expression in Wild Types + CRISPR5-mafbb
No data available
Phenotype
Phenotype resulting from CRISPR5-mafbb
No data available
Phenotype of all Fish created by or utilizing CRISPR5-mafbb
Phenotype Fish Conditions Figures
optic tectum microglial cell gpr34a expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
brain microglial cell p2rx7 expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
brain microglial cell p2ry11 expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
optic tectum microglial cell decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
brain microglial cell p2ry12 expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
brain microglial cell gpr34a expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 4 with image from Lou et al., 2022
microglial cell EGFP expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 1 with image from Lou et al., 2022
microglial cell DsRedx expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg standard conditions Fig. 1 with image from Lou et al., 2022
brain macrophage DsRedx expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg; tsu11Tg/tsu11Tg standard conditions Fig. 2 with image from Lou et al., 2022
brain microglial cell EGFP expression decreased amount, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg; tsu11Tg/tsu11Tg standard conditions Fig. 2 with image from Lou et al., 2022
facial lymphatic network lymphatic vascular process in circulatory system decreased process quality, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nim5Tg; y7Tg standard conditions Fig. 3 with image from Arnold et al., 2022
facial lymphatic network lymphatic vascular process in circulatory system decreased process quality, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg standard conditions Fig. 2 with image from Arnold et al., 2022
facial lymphatic network lymph vasculature decreased thickness, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg standard conditions Fig. 2 with image from Arnold et al., 2022
facial lymphatic network lymph vasculature malformed, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg standard conditions Fig. 2 with image from Arnold et al., 2022
facial lymphatic network lymph vasculature decreased volume, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg standard conditions Fig. 2 with image from Arnold et al., 2022
axial lymph vessel has fewer parts of type facial lymphatic network endothelial cell, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg; y7Tg standard conditions Fig. 1 with image from Arnold et al., 2022
facial lymphatic network has fewer parts of type facial lymphatic network endothelial cell, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg; y7Tg standard conditions Fig. 1 with image from Arnold et al., 2022
intersegmental lymph vessel has fewer parts of type intersegmental lymph vessel endothelial cell, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg; y7Tg standard conditions Fig. 1 with image from Arnold et al., 2022
facial lymphatic network malformed, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; nz101Tg; y7Tg standard conditions Fig. 1 with image from Arnold et al., 2022
facial lymphatic network lymphatic endothelial cell migration decreased process quality, abnormal mafbauq4bh/uq4bh; mafbbuq47bh/uq47bh; uu1kkTg standard conditions Fig. 4 with image from Arnold et al., 2022
spinal cord macrophage EGFP expression increased amount, abnormal mafbbhkz56/hkz56; c264Tg/c264Tg; hkz015tTg/hkz015tTg; szy102Tg/szy102Tg chemical treatment by environment: metronidazole Fig. 3 with image from Lou et al., 2022
spinal cord behavioral response to wounding increased process quality, abnormal mafbbhkz56/hkz56; c264Tg/c264Tg; hkz015tTg/hkz015tTg; szy102Tg/szy102Tg chemical treatment by environment: metronidazole Fig. 3 with image from Lou et al., 2022
optic tectum macrophage DsRedx expression increased amount, abnormal mafbbhkz56/hkz56; hkz013tTg/hkz013tTg; hkz015tTg/hkz015tTg chemical treatment by injection: lysophosphatidylserine 18:1 Fig. 5 with image from Lou et al., 2022
optic tectum macrophage chemotaxis decreased process quality, abnormal mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz013tTg/hkz013tTg; hkz015tTg/hkz015tTg chemical treatment by injection: lysophosphatidylserine 18:1 Fig. 5 with image from Lou et al., 2022
optic tectum macrophage DsRedx expression amount, ameliorated mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz013tTg/hkz013tTg; hkz015tTg/hkz015tTg chemical treatment by injection: lysophosphatidylserine 18:1 Fig. 5 with image from Lou et al., 2022
microglial cell EGFP expression amount, ameliorated mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg; hkz042Tg/hkz042Tg standard conditions Fig. 1 with image from Lou et al., 2022
microglial cell EGFP expression amount, ameliorated mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg; hkz043Tg/hkz043Tg standard conditions Fig. 1 with image from Lou et al., 2022
optic tectum microglial cell decreased amount, ameliorated mafbauq4bh/uq4bh; mafbbhkz56/hkz56; hkz015tTg/hkz015tTg; hkz044Tg/hkz044Tg standard conditions Fig. 4 with image from Lou et al., 2022
Citations