CRISPR

CRISPR1-irx4b

ID
ZDB-CRISPR-221201-5
Name
CRISPR1-irx4b
Previous Names
None
Target
Sequence
5' - GAGTTGCCATAGACCGCAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el834 irx4b
Expression
Gene expression in Wild Types + CRISPR1-irx4b
No data available
Phenotype
Phenotype resulting from CRISPR1-irx4b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-irx4b
Phenotype Fish Conditions Figures
quadrate fused with anguloarticular, abnormal irx1bel833/el833; irx4bel834/el834 standard conditions Fig. 6 with image from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal irx1bel833/el833; irx4bel834/el834 standard conditions Fig. 6 with image from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal irx1bel833/el833; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratohyal bone fused with ceratobranchial 1 bone, abnormal irx1bel833/el833; irx4bel834/el834 standard conditions Fig. 6 with image from Farmer et al., 2021
Meckel's cartilage absent, abnormal irx1bel833/el833; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
pharyngeal arch 3-7 cranial neural crest cell decreased amount, abnormal irx1bel833/el833; irx7el540/el540; irx4bel834/el834 standard conditions Fig. 4 with image from Farmer et al., 2021
neural crest cell dlx2a expression decreased amount, abnormal irx1bel833/el833; irx7el540/el540; irx4bel834/el834 standard conditions Fig. 4 with image from Farmer et al., 2021
cranial neural crest cell sox10 expression decreased amount, abnormal irx1bel833/el833; irx7el540/el540; irx4bel834/el834 standard conditions Fig. 4 with image from Farmer et al., 2021
pharyngeal arch 1 cranial neural crest cell absent, abnormal irx1bel833/el833; irx7el540/el540; irx4bel834/el834; el10Tg standard conditions Fig. 3 with image from Farmer et al., 2021
pharyngeal arch 2 cranial neural crest cell decreased amount, abnormal irx1bel833/el833; irx7el540/el540; irx4bel834/el834; el10Tg standard conditions Fig. 3 with image from Farmer et al., 2021
axis curved dorsal, abnormal irx1bel833/el833; irx1ael830/el830; irx2ael831/el831; irx4ael832/el832; irx4bel834/el834 standard conditions Fig. 1 with image from Farmer et al., 2021
Meckel's cartilage absent, abnormal irx1bel833/el833; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal irx1bel833/el833; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Meckel's cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
neurocranium absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratohyal cartilage decreased size, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Citations