CRISPR

CRISPR2-spega

ID

ZDB-CRISPR-221107-14

Name

CRISPR2-spega

Previous Names

None

Target

spega (1)

Sequence

5' - CTATCGACCTGGACCTGTAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hsc191	spega

Expression

Gene expression in Wild Types + CRISPR2-spega

No data available

Phenotype

Phenotype resulting from CRISPR2-spega

No data available

Phenotype of all Fish created by or utilizing CRISPR2-spega

Phenotype	Fish	Conditions	Figures
skeletal muscle cell perinuclear region of cytoplasm ab1-desm labeling increased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 6. from Espinosa et al., 2022
whole organism spegb expression decreased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 3. from Espinosa et al., 2022
skeletal muscle cell Z disc ab1-desm labeling decreased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 6. from Espinosa et al., 2022
swim bladder uninflated, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 3. from Espinosa et al., 2022
skeletal muscle cell junctional membrane complex Ab2-cacna1s labeling spatial pattern, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022
skeletal muscle cell perinuclear region of cytoplasm ab1-desm labeling spatial pattern, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 6. from Espinosa et al., 2022
skeletal muscle cell junctional membrane complex ab1-ryr labeling spatial pattern, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022
whole organism Ab1-dnm2 labeling increased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 7. from Espinosa et al., 2022
skeletal muscle cell cytoplasm Ab1-dnm2 labeling spatial pattern, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 7. from Espinosa et al., 2022
whole organism lethal (sensu genetics), abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 3. from Espinosa et al., 2022
skeletal muscle cell sarcoplasmic reticulum membrane Ab2-atp2a1 labeling spatial pattern, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022
whole organism ab1-desm labeling increased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 6. from Espinosa et al., 2022
skeletal muscle cell cytoplasm Ab1-dnm2 labeling increased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 7. from Espinosa et al., 2022
skeletal muscle cell Ab1-speg labeling decreased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 3. from Espinosa et al., 2022
whole organism spega expression decreased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 3. from Espinosa et al., 2022
skeletal muscle regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion decreased process quality, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 5. from Espinosa et al., 2022
skeletal muscle cell sarcolemma ab1-ryr labeling mislocalised, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022
swimming decreased process quality, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 5. from Espinosa et al., 2022
skeletal muscle cell cell cortex ab1-desm labeling increased amount, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 6. from Espinosa et al., 2022
skeletal muscle cell has fewer parts of type skeletal muscle cell junctional membrane complex, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022
skeletal muscle cell junctional membrane complex malformed, abnormal	spega^{hsc191/hsc191}; spegb^{hsc192/hsc192} (AB)	standard conditions	Fig. 4. from Espinosa et al., 2022

Citations