CRISPR

CRISPR7-asah1b

ID

ZDB-CRISPR-220923-3

Name

CRISPR7-asah1b

Previous Names

None

Target

asah1b (1)

Sequence

5' - GGGCTTCCCGCTGGGAACAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3576	asah1b

Expression

Gene expression in Wild Types + CRISPR7-asah1b

No data available

Phenotype

Phenotype resulting from CRISPR7-asah1b

No data available

Phenotype of all Fish created by or utilizing CRISPR7-asah1b

Phenotype	Fish	Conditions	Figures
whole organism HexCer(d34:1) increased amount, abnormal	asah1b^{zf3576/zf3576} (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
brain asah1b expression decreased amount, abnormal	asah1b^{zf3576/zf3576} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
whole organism cholesteryl glycoside increased amount, abnormal	asah1a^zf3575/+; asah1b^{zf3576/zf3576} (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism HexCer(d34:1) increased amount, abnormal	asah1a^zf3575/+; asah1b^{zf3576/zf3576} (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism ceramide increased amount, abnormal	asah1a^zf3575/+; asah1b^{zf3576/zf3576} (AB/TL)	control	Fig. 3 from Lelieveld et al., 2022
whole organism D-glucosylsphingosine increased amount, abnormal	asah1a^{zf3575/zf3575}; asah1b^zf3576/+ (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism HexCer(d34:1) increased amount, abnormal	asah1a^{zf3575/zf3575}; asah1b^zf3576/+ (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism HexCer(d34:1) increased amount, abnormal	asah1a^{zf3575/zf3575}; asah1b^{zf3576/zf3576} (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism cholesteryl glycoside increased amount, abnormal	asah1a^{zf3575/zf3575}; asah1b^{zf3576/zf3576} (AB/TL)	chemical treatment by environment: EC 3.2.1.45 (glucosylceramidase) inhibitor	Fig. 3 from Lelieveld et al., 2022
whole organism ceramide increased amount, abnormal	asah1a^{zf3575/zf3575}; asah1b^{zf3576/zf3576} (AB/TL)	control	Fig. 3 from Lelieveld et al., 2022
brain Ab9-sqstm1 labeling increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
liver glucosylceramide increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
brain glucosylceramide increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain gpnmb expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain cholesteryl glycoside increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain il1b expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain apoeb expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
pancreas macrophage aggregated, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
trunk increased curvature, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 7 from Lelieveld et al., 2022
liver Lactosylceramide (d18:1/12:0) increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
whole organism decreased length, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 7 from Lelieveld et al., 2022
brain autophagy decreased process quality, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain sncgb expression decreased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
ventricular zone macrophage increased distribution, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
periventricular grey zone macrophage increased distribution, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
liver gpnmb expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
whole organism dead, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 7 from Lelieveld et al., 2022
brain c1qa expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
ventricular zone macrophage increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
brain c5ar1 expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
liver macrophage aggregated, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
trunk curved, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 7 from Lelieveld et al., 2022
brain th expression amount, ameliorated	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
brain asah1b expression decreased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain mbpa expression decreased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
brain c3a.1 expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain ab2-map1lc3 labeling increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain Lactosylceramide (d18:1/12:0) increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
periventricular grey zone macrophage increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
brain tnfb expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
liver ceramide increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
brain chia.6 expression increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 5 from Lelieveld et al., 2022
brain sncb expression amount, ameliorated	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 6 from Lelieveld et al., 2022
spleen macrophage aggregated, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022
whole organism viability, ameliorated	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 7 from Lelieveld et al., 2022
liver galactosylceramide increased amount, abnormal	asah1b^{zf3576/zf3576}; gba1^{zf3252/zf3252} (AB/TL)	standard conditions	Fig. 4 from Lelieveld et al., 2022

Citations