CRISPR

CRISPR7-pcdh19

ID

ZDB-CRISPR-220916-6

Name

CRISPR7-pcdh19

Previous Names

None

Target

pcdh19 (1)

Sequence

5' - GGAGACGGACAAGATGAATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3559	pcdh19
zf3560	pcdh19

Expression

Gene expression in Wild Types + CRISPR7-pcdh19

No data available

Phenotype

Phenotype resulting from CRISPR7-pcdh19

No data available

Phenotype of all Fish created by or utilizing CRISPR7-pcdh19

Phenotype	Fish	Conditions	Figures
regulation of neuronal action potential process quality, exacerbated	pcdh19^{zf3559/zf3559}	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
retinotectal tract ab9-mapk labeling decreased amount, abnormal	pcdh19^{zf3559/zf3559}	standard conditions	Fig. 3 from Robens et al., 2022
head Ab2-pcdh19 labeling absent, abnormal	pcdh19^{zf3559/zf3559}	standard conditions	Fig. 1 from Robens et al., 2022
optic tectum excitatory postsynaptic potential increased process quality, abnormal	pcdh19^{zf3559/zf3559}	standard conditions	Fig. 2 from Robens et al., 2022
swimming behavior increased process quality, abnormal	pcdh19^{zf3559/zf3559}	standard conditions	Fig. 4 from Robens et al., 2022
regulation of neuronal action potential process quality, exacerbated	pcdh19^{zf3560/zf3560}	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
retinotectal tract ab9-mapk labeling decreased amount, abnormal	pcdh19^{zf3560/zf3560}	standard conditions	Fig. 3 from Robens et al., 2022
optic tectum excitatory postsynaptic potential increased process quality, abnormal	pcdh19^{zf3560/zf3560}	standard conditions	Fig. 2 from Robens et al., 2022
head Ab2-pcdh19 labeling absent, abnormal	pcdh19^{zf3560/zf3560}	standard conditions	Fig. 1 from Robens et al., 2022
swimming behavior increased process quality, abnormal	pcdh19^{zf3560/zf3560}	standard conditions	Fig. 4 from Robens et al., 2022
optic tectum excitatory postsynaptic potential increased process quality, abnormal	WT + CRISPR6-pcdh19 + CRISPR7-pcdh19	standard conditions	Fig. 2 from Robens et al., 2022
retinotectal tract ab9-mapk labeling increased amount, abnormal	WT + CRISPR6-pcdh19 + CRISPR7-pcdh19	control	Fig. 3 from Robens et al., 2022
regulation of neuronal action potential process quality, abnormal	WT + CRISPR6-pcdh19 + CRISPR7-pcdh19	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
regulation of neuronal action potential process quality, exacerbated	pcdh19^zf3559/+	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
optic tectum excitatory postsynaptic potential increased process quality, abnormal	pcdh19^zf3559/+	standard conditions	Fig. 2 from Robens et al., 2022
swimming behavior increased process quality, abnormal	pcdh19^zf3559/+	standard conditions	Fig. 4 from Robens et al., 2022
regulation of neuronal action potential process quality, exacerbated	pcdh19^zf3560/+	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
optic tectum excitatory postsynaptic potential increased process quality, abnormal	pcdh19^zf3560/+	standard conditions	Fig. 2 from Robens et al., 2022
swimming behavior increased process quality, abnormal	pcdh19^zf3560/+	standard conditions	Fig. 4 from Robens et al., 2022
optic tectum inhibitory interneuron decreased amount, abnormal	pcdh19^zf3559/+; nns14Tg; ot1Tg	standard conditions	Fig. 5 from Robens et al., 2022
optic tectum inhibitory interneuron decreased amount, abnormal	pcdh19^zf3560/+; nns14Tg; ot1Tg	standard conditions	Fig. 5 from Robens et al., 2022
regulation of neuronal action potential process quality, abnormal	mitfa^w2/w2; jf4Tg + CRISPR6-pcdh19 + CRISPR7-pcdh19	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
regulation of neuronal action potential process quality, abnormal	mitfa^w2/w2; pcdh19^zf3559/+; jf4Tg	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022
regulation of neuronal action potential process quality, abnormal	mitfa^w2/w2; pcdh19^zf3560/+; jf4Tg	chemical treatment by environment: pentetrazol	Fig. 4 from Robens et al., 2022

Citations