CRISPR

CRISPR1-focad

ID
ZDB-CRISPR-220913-51
Name
CRISPR1-focad
Previous Names
None
Target
Sequence
5' - CTCGGCCTGCTGTAACGCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
imb6 focad
imb7 focad
Expression
Gene expression in Wild Types + CRISPR1-focad
No data available
Phenotype
Phenotype resulting from CRISPR1-focad
No data available
Phenotype of all Fish created by or utilizing CRISPR1-focad
Phenotype Fish Conditions Figures
whole organism semi-viable, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased weight, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver mfap4.12 expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver sh3bp5b expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver mhc1uba expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver cyp3c2 expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver saa expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte vacuolated, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver nlrp3l2 expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver hp expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism brain focad expression absent, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
liver has extra parts of type liver collagen trimer, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver rnasel2 expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte apoptotic process increased occurrence, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
hepatocyte apoptotic, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver focad expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased length, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver lgals8b expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver coch expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte swollen, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased fertility, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.