CRISPR

CRISPR1-nelfb

ID

ZDB-CRISPR-220829-1

Name

CRISPR1-nelfb

Previous Names

None

Target

nelfb (1)

Sequence

5' - GGCAATGCAGACTGTAGGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3621	nelfb

Expression

Gene expression in Wild Types + CRISPR1-nelfb

No data available

Phenotype

Phenotype resulting from CRISPR1-nelfb

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nelfb

Phenotype	Fish	Conditions	Figures
granulocyte differentiation increased process quality, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 , Figure 4 from Huang et al., 2022
whole organism semi-viable, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 1 from Huang et al., 2022
neutrophil mpx expression increased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	control	Figure 2 , Figure 3 , Figure 4 from Huang et al., 2022
lymphoid progenitor cell rag1 expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
whole organism viability, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 1 from Huang et al., 2022
whole organism myb expression decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
whole organism mpx expression increased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	control	Figure 2 , Figure 3 , Figure 6 from Huang et al., 2022
common myeloid progenitor spi1b expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	control	Figure 2 , Figure 3 from Huang et al., 2022
hematopoietic multipotent progenitor cell runx1 expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
neutrophil mpx expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	chemical treatment by environment: alvocidib	Figure 6 from Huang et al., 2022
hematopoietic multipotent progenitor cell tal1 expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	control	Figure 2 , Figure 3 from Huang et al., 2022
granulocyte increased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 , Figure 4 from Huang et al., 2022
neutrophil mpx expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} (AB)	chemical treatment by environment: alvocidib	Figure 3 from Huang et al., 2022
common myeloid progenitor spi1b expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} (AB)	chemical treatment by environment: alvocidib	Figure 3 from Huang et al., 2022
hematopoietic multipotent progenitor cell tal1 expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} (AB)	chemical treatment by environment: alvocidib	Figure 3 from Huang et al., 2022
myeloid cell decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
neutrophil increased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 , Figure 4 , Figure 6 from Huang et al., 2022
common myeloid progenitor myb expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
macrophage mfap4.1 expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 from Huang et al., 2022
whole organism tal1 expression decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 from Huang et al., 2022
whole organism spi1b expression decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 from Huang et al., 2022
whole organism mfap4.1 expression decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 from Huang et al., 2022
whole organism rag1 expression decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 6 from Huang et al., 2022
common myeloid progenitor decreased amount, abnormal	nelfb^{zf3621/zf3621} (AB)	standard conditions	Figure 2 from Huang et al., 2022
neutrophil mpx expression decreased distribution, abnormal	nelfb^{zf3621/zf3621} + MO14-cdk9 (AB)	control	Figure 6 from Huang et al., 2022
hematopoietic multipotent progenitor cell tal1 expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} + MO14-cdk9 (AB)	control	Figure 3 from Huang et al., 2022
neutrophil mpx expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} + MO14-cdk9 (AB)	control	Figure 3 from Huang et al., 2022
whole organism mpx expression amount, ameliorated	nelfb^{zf3621/zf3621} + MO14-cdk9 (AB)	control	Figure 3 from Huang et al., 2022
common myeloid progenitor spi1b expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621} + MO14-cdk9 (AB)	control	Figure 3 from Huang et al., 2022
granulocyte amount, ameliorated	nelfb^{zf3621/zf3621}; zf3623Tg (AB)	standard conditions	Figure 4 from Huang et al., 2022
neutrophil mpx expression spatial pattern, ameliorated	nelfb^{zf3621/zf3621}; zf3623Tg (AB)	standard conditions	Figure 4 from Huang et al., 2022
granulocyte differentiation process quality, ameliorated	nelfb^{zf3621/zf3621}; zf3623Tg (AB)	standard conditions	Figure 4 from Huang et al., 2022
neutrophil amount, ameliorated	nelfb^{zf3621/zf3621}; zf3623Tg (AB)	standard conditions	Figure 4 from Huang et al., 2022

Citations