CRISPR

CRISPR3-lepb

ID

ZDB-CRISPR-220331-13

Name

CRISPR3-lepb

Previous Names

None

Target

lepb (1)

Sequence

5' - CTACCCAATCCCGAGACCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ibl54	lepb
ibl55	lepb

Expression

Gene expression in Wild Types + CRISPR3-lepb

No data available

Phenotype

Phenotype resulting from CRISPR3-lepb

No data available

Phenotype of all Fish created by or utilizing CRISPR3-lepb

Phenotype	Fish	Conditions	Figures
whole organism increased weight, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
male organism renal glomerular capsule increased area, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
male organism glomerular basement membrane increased thickness, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 4 from He et al., 2021
blood glucose increased amount, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
whole organism increased length, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
male organism renal glomerulus hypertrophic, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
renal glomerulus glomerular basement membrane accumulation glomerular basement membrane extracellular matrix, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 4 from He et al., 2021
male organism renal glomerulus increased area, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
whole organism visceral fat increased amount, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 2 from He et al., 2021
male organism pronephric capsular space increased area, abnormal	lepb^ibl54/ibl54 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
whole organism increased length, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
male organism renal glomerulus hypertrophic, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
whole organism increased weight, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
male organism renal glomerulus increased area, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
blood glucose increased amount, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 1 from He et al., 2021
male organism glomerular basement membrane increased thickness, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 4 from He et al., 2021
renal glomerulus glomerular basement membrane accumulation glomerular basement membrane extracellular matrix, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 4 from He et al., 2021
male organism renal glomerular capsule increased area, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021
whole organism visceral fat increased amount, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 2 from He et al., 2021
male organism pronephric capsular space increased area, abnormal	lepb^ibl55/ibl55 (AB/TL)	standard conditions	Fig. 3 from He et al., 2021

Citations