CRISPR

CRISPR2-stc1l

ID

ZDB-CRISPR-220125-5

Name

CRISPR2-stc1l

Previous Names

CRISPR2-stc1l,rhobtb2b

Target

stc1l (1)

Sequence

5' - GCAGATCTCGTGCATGCCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This CRISPR also appears to target the rhobtb2b-202 transcript in Ensembl. However Ensembl database does not support/predict the presence of T202 transcript. It only supports/predict the expression of shorter rhobtb2b transcript (T201), which didn’t share sequence with slc1a).

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mi610	stc1l
mi611	stc1l
mi612	stc1l

Expression

Gene expression in Wild Types + CRISPR2-stc1l

No data available

Phenotype

Phenotype resulting from CRISPR2-stc1l

No data available

Phenotype of all Fish created by or utilizing CRISPR2-stc1l

Phenotype	Fish	Conditions	Figures
heart normal object quality, ameliorated	stc1l^mi610/mi610	chemical treatment by environment: BMS-754807	FIGURE 6 from Li et al., 2021
whole organism edematous, abnormal	stc1l^mi610/mi610	chemical treatment by environment: dimethyl sulfoxide	FIGURE 6 from Li et al., 2021
whole organism dead, abnormal	stc1l^mi610/mi610	chemical treatment by environment: dimethyl sulfoxide	FIGURE 6 from Li et al., 2021
heart normal object quality, ameliorated	stc1l^mi610/mi610	chemical treatment by environment: sirolimus	FIGURE 6 from Li et al., 2021
whole organism dead, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 2 , FIGURE 6 from Li et al., 2021
whole organism pappaa expression increased amount, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 4 from Li et al., 2021
whole organism edematous, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 2 from Li et al., 2021
swim bladder uninflated, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 2 from Li et al., 2021
NaK ionocyte increased amount, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 3 from Li et al., 2021
heart edematous, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 2 , FIGURE 6 from Li et al., 2021
whole organism calcium ion homeostasis decreased process quality, abnormal	stc1l^mi610/mi610	standard conditions	FIGURE 3 from Li et al., 2021
whole organism edematous, abnormal	stc1l^mi611/mi611	standard conditions	FIGURE 2 from Li et al., 2021
whole organism dead, abnormal	stc1l^mi611/mi611	standard conditions	FIGURE 2 , FIGURE 6 from Li et al., 2021
NaK ionocyte increased amount, abnormal	stc1l^mi611/mi611	standard conditions	FIGURE 3 from Li et al., 2021
heart edematous, abnormal	stc1l^mi611/mi611	standard conditions	FIGURE 2 , FIGURE 6 from Li et al., 2021
swim bladder uninflated, abnormal	stc1l^mi611/mi611	standard conditions	FIGURE 2 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: BMS-754807	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: dimethyl sulfoxide	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: MK-2206	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: U0126	FIGURE 5 from Li et al., 2021
yolk syncytial layer ab2-akt labeling increased amount, abnormal	stc1l^mi610/mi610; mi602Tg	standard conditions	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi610/mi610; mi602Tg	standard conditions	FIGURE 3 , FIGURE 4 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: sirolimus	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi610/mi610; mi602Tg	chemical treatment by environment: wortmannin	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi611/mi611; mi602Tg	chemical treatment by environment: U0126	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi611/mi611; mi602Tg	chemical treatment by environment: dimethyl sulfoxide	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi611/mi611; mi602Tg	chemical treatment by environment: sirolimus	FIGURE 5 from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal	stc1l^mi611/mi611; mi602Tg	standard conditions	FIGURE 4 from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated	stc1l^mi611/mi611; mi602Tg	chemical treatment by environment: BMS-754807	FIGURE 5 from Li et al., 2021
heart normal object quality, ameliorated	igfbp5a^mi607/mi607; stc1l^mi610/mi610	standard conditions	FIGURE 6 from Li et al., 2021
heart normal object quality, ameliorated	pappaa^p170/p170; stc1l^mi611/mi611	standard conditions	FIGURE 6 from Li et al., 2021
NaK ionocyte GFP expression decreased amount, abnormal	pappaa^p170/p170; stc1l^mi611/mi611; mi602Tg	standard conditions	FIGURE 4 from Li et al., 2021

Citations