CRISPR

CRISPR3-gstp1.2

ID
ZDB-CRISPR-211208-1
Name
CRISPR3-gstp1.2
Previous Names
  • CRISPR3-gstp1
Target
Sequence
5' - GGACAAAGACCAGCAGCTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
muz301 gstp1.2
Expression
Gene expression in Wild Types + CRISPR3-gstp1.2
No data available
Phenotype
Phenotype resulting from CRISPR3-gstp1.2
No data available
Phenotype of all Fish created by or utilizing CRISPR3-gstp1.2
Phenotype Fish Conditions Figures
whole organism glutathione disulfide decreased amount, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism atf4a expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 5 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 6 from Zhang et al., 2021
pericardium edematous, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 3 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
whole organism baxb expression amount, ameliorated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 7 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 6 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 5Fig. 6Fig. 7 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
whole organism gadd45aa expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 5 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 6 from Zhang et al., 2021
whole organism reactive oxygen species normal amount, ameliorated gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 3 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 3 from Zhang et al., 2021
whole organism reactive oxygen species decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 3 from Zhang et al., 2021
whole organism hspa5 expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 5 from Zhang et al., 2021
caudal fin curved, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 3 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
glutathione transferase activity decreased magnitude, abnormal gstp1.2muz301/muz301 standard conditions Fig. 1 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism tunicamycin, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 7 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 6 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 3 from Zhang et al., 2021
whole organism xbp1 expression amount, ameliorated gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 7 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 6Fig. 7 from Zhang et al., 2021
whole organism ddit3 expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 5 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 4 from Zhang et al., 2021
vertebral column curved, exacerbated gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 3 from Zhang et al., 2021
whole organism ddit3 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 7 from Zhang et al., 2021
whole organism gstp1.2 expression decreased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 1 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism thapsigargin, abnormal gstp1.2muz301/muz301 chemical treatment by environment: thapsigargin Fig. 2 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 6Fig. 7 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 6 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal gstp1.2muz301/muz301 standard conditions Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism PABA/NO, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: tunicamycin Fig. 7 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 7 from Zhang et al., 2021
whole organism viability, abnormal gstp1.2muz301/muz301 standard conditions Fig. 1 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal gstp1.2muz301/muz301 chemical treatment by environment: PABA/NO Fig. 4 from Zhang et al., 2021
Citations