CRISPR

CRISPR2-nr5a1a

ID

ZDB-CRISPR-211206-2

Name

CRISPR2-nr5a1a

Previous Names

None

Target

nr5a1a (1)

Sequence

5' - GTGCGTGCAGACCGGATGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
b1388	nr5a1a

Expression

Gene expression in Wild Types + CRISPR2-nr5a1a

No data available

Phenotype

Phenotype resulting from CRISPR2-nr5a1a

No data available

Phenotype of all Fish created by or utilizing CRISPR2-nr5a1a

Phenotype	Fish	Conditions	Figures
immature gonad decreased size, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 4 from Yan et al., 2021
gonad spermatocyte decreased amount, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 6 from Yan et al., 2021
interrenal vessel cell absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 8 from Yan et al., 2021
hypothalamus nr5a1a expression decreased distribution, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 3 from Yan et al., 2021
whole organism increased length, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 5 from Yan et al., 2021
gonad sperm absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 6 from Yan et al., 2021
whole organism cortisol decreased amount, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 9 from Yan et al., 2021
interrenal primordium nr5a1b expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 3 from Yan et al., 2021
breeding tubercle absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 5 from Yan et al., 2021
interrenal primordium cyp21a2 expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 3 from Yan et al., 2021
interrenal primordium nr5a1a expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 3 from Yan et al., 2021
testis Leydig cell nr5a1b expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
testis Leydig cell cyp11c1 expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
testis nr5a1b expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
gonad decreased size, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 4 from Yan et al., 2021
testis cyp11c1 expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
testis Leydig cell nr5a1a expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
interrenal vessel cell cyp21a2 expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 8 from Yan et al., 2021
whole organism estradiol decreased amount, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 9 from Yan et al., 2021
ovary oocyte stage I immature, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 4 from Yan et al., 2021
testis nr5a1a expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
whole organism 11-oxotestosterone decreased amount, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 9 from Yan et al., 2021
whole organism increased mass, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 5 from Yan et al., 2021
ovary granulosa cell cyp19a1a expression absent, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
testis germ line cell ddx4 expression spatial pattern, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
Sertoli cell amh expression decreased distribution, abnormal	nr5a1a^b1388/b1388	standard conditions	Fig. 7 from Yan et al., 2021
whole organism increased length, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 5 from Yan et al., 2021
immature gonad decreased size, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 4 from Yan et al., 2021
gonad undifferentiated, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 4 from Yan et al., 2021
whole organism cortisol decreased amount, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 9 from Yan et al., 2021
gonad absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 6 from Yan et al., 2021
interrenal primordium nr5a1b expression absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 3 from Yan et al., 2021
hypothalamus nr5a1a expression absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 3 from Yan et al., 2021
interrenal primordium nr5a1a expression absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 3 from Yan et al., 2021
interrenal primordium cyp21a2 expression absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 3 from Yan et al., 2021
breeding tubercle absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 5 from Yan et al., 2021
gonad decreased size, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 4, Fig. 6 from Yan et al., 2021
interrenal vessel cell cyp21a2 expression absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 8 from Yan et al., 2021
whole organism estradiol decreased amount, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 9 from Yan et al., 2021
interrenal vessel absent, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 8 from Yan et al., 2021
whole organism increased mass, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 5 from Yan et al., 2021
whole organism 11-oxotestosterone decreased amount, abnormal	nr5a1a^b1388/b1388; nr5a1b^b1389/b1389	standard conditions	Fig. 9 from Yan et al., 2021

Citations