CRISPR

CRISPR1-mchr2b

ID

ZDB-CRISPR-210817-2

Name

CRISPR1-mchr2b

Previous Names

None

Target

mchr2b (1)

Sequence

5' - GCACAGGACGCCGTAGATTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3415	mchr2b

Expression

Gene expression in Wild Types + CRISPR1-mchr2b

No data available

Phenotype

Phenotype resulting from CRISPR1-mchr2b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mchr2b

Phenotype	Fish	Conditions	Figures
melanocyte melanosome dispersed, abnormal	mchr2b^{zf3415/zf3415}	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome localization decreased process quality, abnormal	mchr2b^{zf3415/zf3415}	standard conditions	Fig 3 , Fig 5 , Fig 6 from Madelaine et al., 2020
melanocyte cellular pigment accumulation increased process quality, abnormal	mchr2b^{zf3415/zf3415}	standard conditions	Fig 3 , Fig 5 , Fig 6 from Madelaine et al., 2020
melanocyte cellular pigment accumulation increased process quality, abnormal	mchr2b^{zf3415/zf3415}	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome dispersed, abnormal	mchr2b^{zf3415/zf3415}	standard conditions	Fig 3 , Fig 5 , Fig 6 from Madelaine et al., 2020
integument background adaptation decreased process quality, abnormal	mchr2b^{zf3415/zf3415}	standard conditions	Fig 3 , Fig 5 , Fig 6 from Madelaine et al., 2020
melanocyte melanosome localization decreased process quality, abnormal	mchr2b^{zf3415/zf3415}	heat shock	Fig 4 from Madelaine et al., 2020
integument background adaptation decreased process quality, abnormal	mchr2b^{zf3415/zf3415}	heat shock	Fig 4 from Madelaine et al., 2020
integument background adaptation decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 5 from Madelaine et al., 2020
melanocyte melanosome localization process quality, ameliorated	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 6 from Madelaine et al., 2020
melanocyte melanosome structure, ameliorated	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 6 from Madelaine et al., 2020
melanocyte cellular pigment accumulation process quality, ameliorated	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 6 from Madelaine et al., 2020
integument background adaptation process quality, ameliorated	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 6 from Madelaine et al., 2020
melanocyte melanosome localization decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 5 from Madelaine et al., 2020
melanocyte cellular pigment accumulation increased process quality, abnormal	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 5 from Madelaine et al., 2020
melanocyte melanosome dispersed, abnormal	mchr2b^{zf3415/zf3415}; pomca^{zf3414/zf3414}	standard conditions	Fig 5 from Madelaine et al., 2020
integument background adaptation decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3412Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte cellular pigment accumulation increased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3412Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome localization decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3412Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome dispersed, abnormal	mchr2b^{zf3415/zf3415}; zf3412Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte cellular pigment accumulation increased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3580Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome localization decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3580Tg	heat shock	Fig 4 from Madelaine et al., 2020
melanocyte melanosome dispersed, abnormal	mchr2b^{zf3415/zf3415}; zf3580Tg	heat shock	Fig 4 from Madelaine et al., 2020
integument background adaptation decreased process quality, abnormal	mchr2b^{zf3415/zf3415}; zf3580Tg	heat shock	Fig 4 from Madelaine et al., 2020

Citations