CRISPR

CRISPR1-gpr101

ID

ZDB-CRISPR-210816-2

Name

CRISPR1-gpr101

Previous Names

None

Target

gpr101 (1)

Sequence

5' - GGCAGCCCTGTCGCCCTCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
y629	gpr101
y630	gpr101

Expression

Gene expression in Wild Types + CRISPR1-gpr101

No data available

Phenotype

Phenotype resulting from CRISPR1-gpr101

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gpr101

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 3 , Fig. S9 from Trivellin et al., 2020
whole organism sst1.1 expression decreased amount, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism igf2a expression decreased amount, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased weight, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. S9 from Trivellin et al., 2020
brain necrotic, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
hypothalamus increased size, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
fertilization decreased rate, abnormal	gpr101^y629/y629 (EKW)	standard conditions	text only from Trivellin et al., 2020
midbrain hindbrain boundary absent, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
hypophysis increased size, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
diencephalon dorsal side decreased size, abnormal	gpr101^y629/y629 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
whole organism decreased length, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 3 , Fig. S9 from Trivellin et al., 2020
whole organism sst1.1 expression decreased amount, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism igf2a expression decreased amount, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased weight, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. S9 from Trivellin et al., 2020
brain necrotic, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
hypothalamus increased size, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
hypophysis increased size, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
fertilization decreased rate, abnormal	gpr101^y630/y630 (EKW)	standard conditions	text only from Trivellin et al., 2020
midbrain hindbrain boundary absent, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
diencephalon dorsal side decreased size, abnormal	gpr101^y630/y630 (EKW)	standard conditions	Fig. 4 from Trivellin et al., 2020
whole organism decreased length, abnormal	gpr101^y629/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020
midbrain hindbrain boundary absent, abnormal	gpr101^y629/+ (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased weight, abnormal	gpr101^y629/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020
brain necrotic, abnormal	gpr101^y629/+ (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased length, abnormal	gpr101^y630/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020
midbrain hindbrain boundary absent, abnormal	gpr101^y630/+ (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased weight, abnormal	gpr101^y630/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020
brain necrotic, abnormal	gpr101^y630/+ (EKW)	standard conditions	Fig. 3 from Trivellin et al., 2020
whole organism decreased length, abnormal	gpr101^y629/+; gpr101^y630/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020
whole organism decreased weight, abnormal	gpr101^y629/+; gpr101^y630/+ (EKW)	standard conditions	Fig. S8 from Trivellin et al., 2020

Citations