CRISPR

CRISPR4-hey2

ID

ZDB-CRISPR-210623-3

Name

CRISPR4-hey2

Previous Names

None

Target

hey2 (1)

Sequence

5' - GTCGGACGTGCTGTCCTCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3471	hey2
zf3472	hey2

Expression

Gene expression in Wild Types + CRISPR4-hey2

No data available

Phenotype

Phenotype resulting from CRISPR4-hey2

No data available

Phenotype of all Fish created by or utilizing CRISPR4-hey2

Phenotype	Fish	Conditions	Figures
heart pygl expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart ogna expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
cardiac muscle cell cell division decreased frequency, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene, chemical treatment by environment: LLY-507	Fig. 5 from She et al., 2020
heart ccnd1 expression decreased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 7 from She et al., 2020
heart smyd2a expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart cldn7a expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart ndrg3a expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart Ab1-smyd2 labeling increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 6 from She et al., 2020
heart smyd2b expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart Ab12-stat3 labeling increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 6 from She et al., 2020
cardiac muscle cell ab1-mef2 labeling increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle	Fig. 2 from She et al., 2020
cardiac muscle cell nucleus Ab12-stat3 labeling increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 7 from She et al., 2020
myocardium regeneration increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle	Fig. 2 from She et al., 2020
regulation of amino acid biosynthetic process increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
cardiac muscle cell nucleus Ab12-stat3 labeling amount, ameliorated	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene, chemical treatment by environment: LLY-507	Fig. 7 from She et al., 2020
heart Ab1-MethylatedLysine labeling increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 6 from She et al., 2020
cardiac muscle cell nucleus Ab12-stat3 labeling amount, ameliorated	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene, chemical treatment by environment: AZ505	Fig. 7 from She et al., 2020
heart smyd1a expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart membrane lipid metabolic process increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart contraction increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
heart bcl2a expression decreased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 7 from She et al., 2020
heart smyd1b expression increased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
cardiac muscle cell cell division increased frequency, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle	Fig. 2 from She et al., 2020
cardiac muscle cell cell division decreased frequency, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene, chemical treatment by environment: AZ505	Fig. 5 from She et al., 2020
myocardium connective tissue replacement involved in inflammatory response wound healing increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle	Fig. 2 from She et al., 2020
heart socs3b expression decreased amount, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 7 from She et al., 2020
heart cell division increased process quality, abnormal	hey2^{zf3471/zf3471}	resection: cardiac ventricle, chemical treatment by environment: afimoxifene	Fig. 4 from She et al., 2020
cardiac muscle cell ab1-mef2 labeling increased amount, abnormal	hey2^{zf3472/zf3472}	resection: cardiac ventricle	Fig. 2 from She et al., 2020
cardiac muscle cell cell division increased frequency, abnormal	hey2^{zf3472/zf3472}	resection: cardiac ventricle	Fig. 2 from She et al., 2020

Citations