CRISPR

CRISPR14-foxc1a

ID

ZDB-CRISPR-210510-1

Name

CRISPR14-foxc1a

Previous Names

None

Target

foxc1a (1)

Sequence

5' - GGGGGTTTCACCATATCCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mw711	foxc1a

Expression

Gene expression in Wild Types + CRISPR14-foxc1a

No data available

Phenotype

Phenotype resulting from CRISPR14-foxc1a

No data available

Phenotype of all Fish created by or utilizing CRISPR14-foxc1a

Phenotype	Fish	Conditions	Figures
eye malformed, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
heart edematous, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
caudal vein edematous, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
eye decreased size, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
camera-type eye morphogenesis decreased process quality, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
anterior segment eye lacks all parts of type anterior chamber eye, abnormal	foxc1a^mw711/mw711	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
eye pitx2 expression increased amount, abnormal	foxc1a^mw711/+	standard conditions	Fig. 4 from Ferre-Fernández et al., 2020
eye foxc1a expression increased amount, abnormal	foxc1a^mw711/+	standard conditions	Fig. 4 from Ferre-Fernández et al., 2020
eye pitx2 expression decreased amount, abnormal	foxc1a^mw711/+	standard conditions	Fig. 4 from Ferre-Fernández et al., 2020
retina vasculature development in camera-type eye decreased process quality, abnormal	foxc1a^mw711/mw711; y1Tg	standard conditions	Fig. 3 from Ferre-Fernández et al., 2020
ocular blood vessel malformed, abnormal	foxc1a^mw711/mw711; y1Tg	standard conditions	Fig. 3 from Ferre-Fernández et al., 2020
brain vasculature lacks all parts of type central artery, abnormal	foxc1a^mw711/mw711; y1Tg	standard conditions	Fig. 3 from Ferre-Fernández et al., 2020
ventral mandibular arch decreased length, abnormal	foxc1a^mw711/+; foxc1b^mw713/mw713	standard conditions	Fig. 5 from Ferre-Fernández et al., 2020
compact layer of ventricle increased thickness, abnormal	foxc1a^mw711/+; foxc1b^mw713/mw713	standard conditions	Fig. 6 from Ferre-Fernández et al., 2020
head decreased size, abnormal	foxc1a^mw711/+; foxc1b^mw713/mw713	standard conditions	Fig. 5 from Ferre-Fernández et al., 2020
vertebral column curved, abnormal	foxc1a^mw711/+; foxc1b^mw713/mw713	standard conditions	Fig. 5 from Ferre-Fernández et al., 2020
eye decreased size, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1, Fig. 2 from Ferre-Fernández et al., 2020
neurocranium lacks all parts of type neurocranial trabecula, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
pharyngeal arch 2 skeleton lacks all parts of type basihyal cartilage, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
mandibular arch skeleton lacks all parts of type palatoquadrate cartilage, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
ceratohyal cartilage decreased size, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
heart edematous, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
eye pitx2 expression decreased amount, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 4 from Ferre-Fernández et al., 2020
anterior segment eye lacks all parts of type anterior chamber eye, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1, Fig. 2 from Ferre-Fernández et al., 2020
eye malformed, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
eye foxc1a expression increased amount, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 4 from Ferre-Fernández et al., 2020
eye edematous, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
lens opaque, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020
caudal vein edematous, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1 from Ferre-Fernández et al., 2020
camera-type eye morphogenesis decreased process quality, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 1, Fig. 2 from Ferre-Fernández et al., 2020
embryonic cranial skeleton morphogenesis decreased process quality, abnormal	foxc1a^mw711/mw711; foxc1b^mw713/mw713	standard conditions	Fig. 2 from Ferre-Fernández et al., 2020

Citations