CRISPR

CRISPR6-thrb

ID

ZDB-CRISPR-210324-27

Name

CRISPR6-thrb

Previous Names

None

Target

thrb (1)

Sequence

5' - GGAAGAGTGGGAGATGATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
stl627	thrb
stl628	thrb

Expression

Gene expression in Wild Types + CRISPR6-thrb

No data available

Phenotype

Phenotype resulting from CRISPR6-thrb

No data available

Phenotype of all Fish created by or utilizing CRISPR6-thrb

Phenotype	Fish	Conditions	Figures
retina si:busm1-57f23.1 expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retinal cone cell ab3-rho labeling amount, ameliorated	thrb^{stl627/stl627}	standard conditions	Fig. 3 from Volkov et al., 2020
retina mhc1uba expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retinal cone cell arr3b expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 3 from Volkov et al., 2020
retina opn1lw2 expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retinal cone cell decreased amount, abnormal	thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 3 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal	thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
retina detection of visible light decreased efficacy, abnormal	thrb^{stl627/stl627}	visible light	Fig. 4 from Volkov et al., 2020
retinal cone cell arr3a expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 3 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
retina mir726 expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retina serinc2 expression increased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retina opn1lw1 expression decreased amount, abnormal	thrb^{stl627/stl627}	standard conditions	Fig. 5 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell ab3-rho labeling absent, abnormal	thrb^{stl627/stl627}; q22Tg	standard conditions	Fig. 6 from Volkov et al., 2020
retinal cone cell retinal cone cell differentiation disrupted, abnormal	thrb^{stl627/stl627}; q22Tg	standard conditions	Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer arr3a expression mislocalised, abnormal	thrb^{stl627/stl627}; q22Tg	standard conditions	Fig. 6 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell cell morphology, abnormal	thrb^{stl627/stl627}; q22Tg	standard conditions	Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer Tomato expression mislocalised, abnormal	thrb^{stl627/stl627}; q22Tg	standard conditions	Fig. 6 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thraa^{vp33rc1/vp33rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal	thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol normal amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020

Citations