CRISPR

CRISPR6-thrb

ID
ZDB-CRISPR-210324-27
Name
CRISPR6-thrb
Previous Names
None
Target
Sequence
5' - GGAAGAGTGGGAGATGATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
stl627 thrb
stl628 thrb
Expression
Gene expression in Wild Types + CRISPR6-thrb
No data available
Phenotype
Phenotype resulting from CRISPR6-thrb
No data available
Phenotype of all Fish created by or utilizing CRISPR6-thrb
Phenotype Fish Conditions Figures
retina si:busm1-57f23.1 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal cone cell ab3-rho labeling amount, ameliorated thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
retina mhc1uba expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal cone cell arr3b expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
retina opn1lw2 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal cone cell decreased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 3 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
retina detection of visible light decreased efficacy, abnormal thrbstl627/stl627 visible light Fig. 4 from Volkov et al., 2020
retinal cone cell arr3a expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
retina mir726 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retina serinc2 expression increased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retina opn1lw1 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell ab3-rho labeling absent, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal cone cell retinal cone cell differentiation disrupted, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer arr3a expression mislocalised, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell cell morphology, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer Tomato expression mislocalised, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, ameliorated thraavp33rc1/vp33rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thraavp33rc1/vp33rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression amount, ameliorated thraavp33rc1/vp33rc1; thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol normal amount, ameliorated thraavp33rc1/vp33rc1; thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
Citations