CRISPR

CRISPR2-msmo1

ID
ZDB-CRISPR-210319-6
Name
CRISPR2-msmo1
Previous Names
None
Target
Sequence
5' - GGCTGTGCCGTTCACCTCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nu81 msmo1
Expression
Gene expression in Wild Types + CRISPR2-msmo1
No data available
Phenotype
Phenotype resulting from CRISPR2-msmo1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-msmo1
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal msmo1nu81/nu81 standard conditions Fig. 2. with imageFig. 3. with image from Anderson et al., 2020
whole organism cholesterol decreased amount, abnormal msmo1nu81/nu81 standard conditions text only from Anderson et al., 2020
whole organism dead, abnormal msmo1nu81/nu81 standard conditions Fig. 2. with imageFig. 3. with image from Anderson et al., 2020
postcranial axial skeleton ossification increased process quality, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
endochondral bone ossification increased process quality, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
head decreased size, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
hyomandibula condensed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
hyomandibula deformed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
hypural deformed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
whole organism decreased length, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
cranium ossification increased process quality, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
cranium malformed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
palatoquadrate arch endochondral element punctate, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 7. with image from Anderson et al., 2020
ceratohyal bone condensed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
postcranial axial skeleton malformed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 1. with image from Anderson et al., 2020
palatoquadrate arch ossification increased process quality, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 7. with image from Anderson et al., 2020
ceratohyal bone deformed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
hypural condensed, abnormal msmo1nu81/+; msmo1nu7/+ standard conditions Fig. 4. with image from Anderson et al., 2020
whole organism dead, abnormal lssnu60/+; msmo1nu81/nu81 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism decreased life span, abnormal lssnu60/+; msmo1nu81/nu81 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism embryo development delayed, abnormal lssnu60/nu60; msmo1nu81/nu81 standard conditions text only from Anderson et al., 2020
endochondral bone ossification increased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
pterotic hypertrophic chondrocyte col10a1a expression decreased distribution, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
pterotic hypertrophic chondrocyte msmo1 expression increased distribution, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
postcranial axial skeleton ossification increased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 2. with image from Anderson et al., 2020
head decreased size, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 2. with image from Anderson et al., 2020
hyomandibula deformed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
hypural deformed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
hyomandibula condensed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
cranium ossification increased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 2. with image from Anderson et al., 2020
palatoquadrate arch endochondral element punctate, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 7. with image from Anderson et al., 2020
ceratohyal bone condensed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
cranium malformed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 2. with image from Anderson et al., 2020
pterotic chondrocyte col2a1a expression increased distribution, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
pterotic chondrocyte differentiation decreased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
ceratohyal bone deformed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
postcranial axial skeleton malformed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 2. with image from Anderson et al., 2020
palatoquadrate arch ossification increased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 7. with image from Anderson et al., 2020
pterotic columnar chondrocyte msmo1 expression increased distribution, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
hypural condensed, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 4. with image from Anderson et al., 2020
pterotic growth plate cartilage morphogenesis decreased process quality, abnormal msmo1nu81/nu81; nu100Tg standard conditions Fig. 5. with image from Anderson et al., 2020
Citations