CRISPR

CRISPR1-bmpr2a

ID
ZDB-CRISPR-210219-3
Name
CRISPR1-bmpr2a
Previous Names
None
Target
Sequence
5' - GGTCTGGCCGAGCGGATTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo25 bmpr2a
Expression
Gene expression in Wild Types + CRISPR1-bmpr2a
No data available
Phenotype
Phenotype resulting from CRISPR1-bmpr2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-bmpr2a
Phenotype Fish Conditions Figures
male organism increased weight, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
gonad hypertrophic, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
testis meiosis I decreased process quality, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
gonad increased weight, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
ovary hypertrophic, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/umo25 (AB) standard conditions Fig. 3 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
whole organism semi-fertile, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
caudal fin fin regeneration decreased process quality, abnormal bmpr2aumo25/umo25; bmpr2bumo26/umo26 (AB) standard conditions Fig. S3 from Zhang et al., 2020
Citations