CRISPR

CRISPR1-irf2bp2b

ID
ZDB-CRISPR-201203-5
Name
CRISPR1-irf2bp2b
Previous Names
None
Target
Sequence
5' - GGAATGGCTCCGGTCCGACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3145 irf2bp2b
Expression
Gene expression in Wild Types + CRISPR1-irf2bp2b
No data available
Phenotype
Phenotype resulting from CRISPR1-irf2bp2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-irf2bp2b
Phenotype Fish Conditions Figures
head kidney granulocyte decreased amount, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 3 from Wang et al., 2019
mature neutrophil lyz expression decreased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2 from Wang et al., 2019
monocyte csf1ra expression increased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2 from Wang et al., 2019
macrophage increased amount, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 4 from Wang et al., 2019
macrophage mfap4.1 expression increased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2Fig. 4 from Wang et al., 2019
neutrophil decreased amount, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 4 from Wang et al., 2019
immature neutrophil cebp1 expression decreased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2 from Wang et al., 2019
head kidney monocyte increased amount, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 3 from Wang et al., 2019
ventral wall of dorsal aorta neutrophil decreased amount, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2 from Wang et al., 2019
mature neutrophil mpx expression decreased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2Fig. 4 from Wang et al., 2019
macrophage mpeg1.1 expression increased distribution, abnormal irf2bp2bzf3145/zf3145 standard conditions Fig. 2 from Wang et al., 2019
macrophage increased amount, abnormal irf2bp2bzf3145/zf3145; gl22Tg standard conditions Fig. 2 from Wang et al., 2019
caudal hematopoietic tissue macrophage increased amount, abnormal irf2bp2bzf3145/zf3145; gl22Tg standard conditions Fig. 2 from Wang et al., 2019
head kidney neutrophil decreased amount, abnormal irf2bp2bzf3145/zf3145; rj30Tg standard conditions Fig. 3 from Wang et al., 2019
neutrophil decreased amount, abnormal irf2bp2bzf3145/zf3145; rj30Tg standard conditions Fig. 2 from Wang et al., 2019
caudal hematopoietic tissue neutrophil decreased amount, abnormal irf2bp2bzf3145/zf3145; rj30Tg standard conditions Fig. 2 from Wang et al., 2019
mature neutrophil mpx expression amount, ameliorated irf2bp2bzf3145/zf3145 + MO7-spi1b standard conditions Fig. 4 from Wang et al., 2019
macrophage amount, ameliorated irf2bp2bzf3145/zf3145 + MO7-spi1b standard conditions Fig. 4 from Wang et al., 2019
neutrophil amount, ameliorated irf2bp2bzf3145/zf3145 + MO7-spi1b standard conditions Fig. 4 from Wang et al., 2019
macrophage mfap4.1 expression amount, ameliorated irf2bp2bzf3145/zf3145 + MO7-spi1b standard conditions Fig. 4 from Wang et al., 2019
Citations