CRISPR

CRISPR1-pax1b

ID

ZDB-CRISPR-201110-2

Name

CRISPR1-pax1b

Previous Names

None

Target

pax1b (1)

Sequence

5' - GGGGAGGTGAATCAGCTCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
as37	pax1b

Expression

Gene expression in Wild Types + CRISPR1-pax1b

No data available

Phenotype

Phenotype resulting from CRISPR1-pax1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-pax1b

Phenotype	Fish	Conditions	Figures
pharyngeal pouch 3 tbx1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 edn1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 2 nkx2.3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 4 tbx1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal arch 4 hand2 expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 1 fgf3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
ceratobranchial cartilage absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal pouch 5 tbx1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 3 edn1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 fgf3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 5 hand2 expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 2 tbx1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 3 nkx2.3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 3 fgf3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 3 hand2 expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 5 nkx2.3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal arch 6 dlx2a expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 4 nkx2.3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 2 edn1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 2 fgf3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 4 fgf3 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 4 edn1 expression absent, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 6 hand2 expression decreased amount, abnormal	pax1b^as37/as37 + MO1-pax1a	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 3 tbx1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 edn1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 2 nkx2.3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 4 tbx1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 4 hand2 expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 3 morphology, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 5 morphology, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 1 fgf3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 tbx1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 3 edn1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 fgf3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 5 hand2 expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
ceratobranchial 1 cartilage absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 1 alcama expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 3 fgf3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 3 nkx2.3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 2 tbx1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 4 alcama expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal arch 3 hand2 expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 2 morphology, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
basibranchial 3 absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
basibranchial 4 absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
ceratobranchial 3 cartilage absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
basibranchial 2 absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal pouch 3 alcama expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 5 nkx2.3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 4 morphology, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal arch 6 dlx2a expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 2 alcama expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 4 nkx2.3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
pharyngeal pouch 2 fgf3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 2 edn1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal pouch 5 alcama expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 9 from Liu et al., 2020
ceratobranchial 5 cartilage decreased length, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal pouch 4 fgf3 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020
pharyngeal arch 6 hand2 expression decreased amount, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 6 from Liu et al., 2020
pharyngeal pouch 4 edn1 expression absent, abnormal	pax1a^as36/as36; pax1b^as37/as37	standard conditions	Fig. 10 from Liu et al., 2020

Citations