CRISPR

CRISPR2-nomo

ID
ZDB-CRISPR-200917-2
Name
CRISPR2-nomo
Previous Names
None
Target
Sequence
5' - CGATGAGAAGAGCCCCCCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3106 nomo
Expression
Gene expression in Wild Types + CRISPR2-nomo
No data available
Phenotype
Phenotype resulting from CRISPR2-nomo
No data available
Phenotype of all Fish created by or utilizing CRISPR2-nomo
Phenotype Fish Conditions Figures
otic vesicle sox9b expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
pharyngeal arch dlx1a expression decreased distribution, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
whole organism dlx1a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
pharyngeal arch dlx2a expression decreased distribution, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
cleithrum sox9a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
whole organism sox9a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
cleithrum col11a2 expression absent, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
whole organism dlx2a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
ceratohyal cartilage hypoplastic, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
cleithrum col11a2 expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
palatoquadrate cartilage hypoplastic, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
ceratohyal cartilage morphology, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
whole organism sp7 expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 7 from Cao et al., 2018
whole organism sox9b expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
pectoral fin sox9a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
otic vesicle col11a2 expression absent, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
pharyngeal arch col11a2 expression decreased distribution, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
Meckel's cartilage decreased size, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
parasphenoid sp7 expression spatial pattern, abnormal nomozf3106/zf3106 standard conditions Fig. 7 from Cao et al., 2018
ethmoid cartilage decreased size, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
Meckel's cartilage hypoplastic, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
pectoral fin sox9b expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
otic vesicle sox9a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
cleithrum sp7 expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 7 from Cao et al., 2018
ceratobranchial cartilage morphology, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
whole organism col10a1a expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
whole organism col11a2 expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
ceratobranchial cartilage aplastic/hypoplastic, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
Meckel's cartilage morphology, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
ceratobranchial cartilage sp7 expression absent, abnormal nomozf3106/zf3106 standard conditions Fig. 7 from Cao et al., 2018
cleithrum sox9b expression decreased amount, abnormal nomozf3106/zf3106 standard conditions Fig. 4 from Cao et al., 2018
palatoquadrate cartilage morphology, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
ceratobranchial cartilage col11a2 expression absent, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
cleithrum col10a1a expression absent, abnormal nomozf3106/zf3106 standard conditions Fig. 5 from Cao et al., 2018
ceratobranchial cartilage decreased size, abnormal nomozf3106/zf3106 standard conditions Fig. 3 from Cao et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.