CRISPR

CRISPR1-cndp1

ID
ZDB-CRISPR-200610-1
Name
CRISPR1-cndp1
Previous Names
  • CRISPR1-zgc:114181
Target
Sequence
5' - GGACGTCCAGCCCGCCAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3241 cndp1
zf3242 cndp1
zf3243 cndp1
Expression
Gene expression in Wild Types + CRISPR1-cndp1
No data available
Phenotype
Phenotype resulting from CRISPR1-cndp1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cndp1
Phenotype Fish Conditions Figures
whole organism alanine decreased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism serine decreased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism glycine decreased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 7 from Schmöhl et al., 2019
blood glucose increased amount, abnormal cndp1zf3241/zf3241 increased food availability Fig. 11 from Schmöhl et al., 2019
whole organism histidine decreased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 7 from Schmöhl et al., 2019
brain carnosine increased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 3 from Schmöhl et al., 2019
brain carnosine metabolic process decreased occurrence, abnormal cndp1zf3241/zf3241 standard conditions Fig. 3 from Schmöhl et al., 2019
whole organism increased weight, abnormal cndp1zf3241/zf3241 increased food availability Fig. 11 from Schmöhl et al., 2019
whole organism cysteine decreased amount, abnormal cndp1zf3241/zf3241 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism alanine decreased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism glycine decreased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism serine decreased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 7 from Schmöhl et al., 2019
blood glucose increased amount, abnormal cndp1zf3242/zf3242 increased food availability Fig. 11 from Schmöhl et al., 2019
whole organism histidine decreased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 7 from Schmöhl et al., 2019
brain carnosine metabolic process decreased occurrence, abnormal cndp1zf3242/zf3242 standard conditions Fig. 3 from Schmöhl et al., 2019
brain carnosine increased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 3 from Schmöhl et al., 2019
whole organism increased weight, abnormal cndp1zf3242/zf3242 increased food availability Fig. 11 from Schmöhl et al., 2019
whole organism cysteine decreased amount, abnormal cndp1zf3242/zf3242 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism alanine decreased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism glycine decreased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism serine decreased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 7 from Schmöhl et al., 2019
blood glucose increased amount, abnormal cndp1zf3243/zf3243 increased food availability Fig. 11 from Schmöhl et al., 2019
whole organism histidine decreased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 7 from Schmöhl et al., 2019
brain carnosine metabolic process decreased occurrence, abnormal cndp1zf3243/zf3243 standard conditions Fig. 3 from Schmöhl et al., 2019
brain carnosine increased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 3 from Schmöhl et al., 2019
whole organism cysteine decreased amount, abnormal cndp1zf3243/zf3243 standard conditions Fig. 7 from Schmöhl et al., 2019
whole organism increased weight, abnormal cndp1zf3243/zf3243 increased food availability Fig. 11 from Schmöhl et al., 2019
renal glomerulus decreased length, abnormal cndp1zf3241/zf3241; li1Tg standard conditions Fig. 6 from Schmöhl et al., 2019
whole organism methylglyoxal increased amount, abnormal cndp1zf3241/zf3241; y1Tg chemical treatment by environment: methylglyoxal Fig. 9 from Schmöhl et al., 2019
renal glomerulus decreased length, abnormal cndp1zf3242/zf3242; li1Tg standard conditions Fig. 6 from Schmöhl et al., 2019
whole organism methylglyoxal increased amount, abnormal cndp1zf3242/zf3242; y1Tg chemical treatment by environment: methylglyoxal Fig. 9 from Schmöhl et al., 2019
renal glomerulus decreased length, abnormal cndp1zf3243/zf3243; li1Tg standard conditions Fig. 6 from Schmöhl et al., 2019
whole organism methylglyoxal increased amount, abnormal cndp1zf3243/zf3243; y1Tg chemical treatment by environment: methylglyoxal Fig. 9 from Schmöhl et al., 2019
whole organism glucose increased amount, abnormal cndp1zf3241/zf3241 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
whole organism glucose increased amount, abnormal cndp1zf3242/zf3242 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
whole organism glucose increased amount, abnormal cndp1zf3243/zf3243 + MO1-pdx1 standard conditions Fig. 9 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
vasculature morphology, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3241/zf3241; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
vasculature morphology, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3242/zf3242; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
pronephric tubule decreased length, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
renal glomerulus increased length, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
vasculature morphology, abnormal cndp1zf3243/zf3243; y1Tg + MO1-pdx1 standard conditions Fig. 10 from Schmöhl et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.