CRISPR

CRISPR1-slco1c1

ID
ZDB-CRISPR-200409-1
Name
CRISPR1-slco1c1
Previous Names
None
Target
Sequence
5' - GCTTGAGCAACAGCGCCGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
biu16 slco1c1
Expression
Gene expression in Wild Types + CRISPR1-slco1c1
No data available
Phenotype
Phenotype resulting from CRISPR1-slco1c1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-slco1c1
Phenotype Fish Conditions Figures
brain gfap expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
thyroid follicle red, abnormal slco1c1biu16/biu16 chemical treatment by environment: thyroxine Fig. 6 from Admati et al., 2019
thyroid gland development process quality, abnormal slco1c1biu16/biu16 standard conditions Fig. 5 from Admati et al., 2019
thyroid follicle tg expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
radial glial cell cell projection morphology, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
whole organism tshba expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
hypocretin-secreting neuron axon development process quality, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
hypophysis tshba expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
thyroid follicle red, abnormal slco1c1biu16/biu16 control Fig. 6 from Admati et al., 2019
locomotion involved in locomotory behavior increased occurrence, abnormal slco1c1biu16/biu16 standard conditions Fig. 3 from Admati et al., 2019
thyroid follicle color, ameliorated slco1c1biu16/biu16 chemical treatment by environment: 3,5-diiodothyropropionic acid Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slco1c1biu16/biu16 chemical treatment by environment: 3,5-diiodothyropropionic acid Fig. 6 from Admati et al., 2019
radial glial cell glial cell development process quality, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
hypothalamus axon development process quality, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
response to light intensity process quality, abnormal slco1c1biu16/biu16 standard conditions Fig. 3 from Admati et al., 2019
thyroid follicle red, abnormal slco1c1biu16/biu16 chemical treatment by environment: 3,3',5-triiodo-L-thyronine Fig. 6 from Admati et al., 2019
thyroid follicle tg expression increased distribution, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
thyroid follicle size, ameliorated slco1c1biu16/biu16 chemical treatment by environment: tiratricol Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slco1c1biu16/biu16 chemical treatment by environment: 3,3',5-triiodo-L-thyronine Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slco1c1biu16/biu16 control Fig. 5,  Fig. 6 from Admati et al., 2019
whole organism trh expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
thyroid follicle color, ameliorated slco1c1biu16/biu16 chemical treatment by environment: tiratricol Fig. 6 from Admati et al., 2019
hypothalamus trh expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
hypophysis tshba expression increased distribution, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slco1c1biu16/biu16 chemical treatment by environment: thyroxine Fig. 6 from Admati et al., 2019
whole organism tg expression increased amount, abnormal slco1c1biu16/biu16 standard conditions Fig. 2 from Admati et al., 2019
hypocretin-secreting neuron axon decreased length, abnormal slco1c1biu16/biu16 standard conditions Fig. 4 from Admati et al., 2019
radial glial cell glial cell development process quality, abnormal slco1c1biu16/biu16; ck1Tg standard conditions Fig. 4 from Admati et al., 2019
radial glial cell cell projection increased length, abnormal slco1c1biu16/biu16; ck1Tg standard conditions Fig. 4 from Admati et al., 2019
thyroid gland development process quality, exacerbated slc16a2biu4/biu4; slco1c1biu16/biu16 standard conditions Fig. 5 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: 3,3',5-triiodo-L-thyronine Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: thyroxine Fig. 6 from Admati et al., 2019
thyroid follicle color, ameliorated slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: tiratricol Fig. 6 from Admati et al., 2019
thyroid follicle red, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: 3,5-diiodothyropropionic acid Fig. 6 from Admati et al., 2019
thyroid follicle red, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 control Fig. 6 from Admati et al., 2019
thyroid follicle red, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: 3,3',5-triiodo-L-thyronine Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 control Fig. 6 from Admati et al., 2019
thyroid follicle size, ameliorated slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: tiratricol Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: 3,5-diiodothyropropionic acid Fig. 6 from Admati et al., 2019
thyroid follicle red, abnormal slc16a2biu4/biu4; slco1c1biu16/biu16 chemical treatment by environment: thyroxine Fig. 6 from Admati et al., 2019
thyroid follicle hyperplastic, exacerbated slc16a2biu4/biu4; slco1c1biu16/biu16 standard conditions Fig. 5 from Admati et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.