CRISPR

CRISPR3-amh

ID
ZDB-CRISPR-200408-1
Name
CRISPR3-amh
Previous Names
None
Target
Sequence
5' - GGAATGCTTTGGGAACGTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1373 amh
b1374 amh
b1375 amh
Expression
Gene expression in Wild Types + CRISPR3-amh
No data available
Phenotype
Phenotype resulting from CRISPR3-amh
No data available
Phenotype of all Fish created by or utilizing CRISPR3-amh
Phenotype Fish Conditions Figures
ovarian follicle stage II bmp15 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
female organism pleuroperitoneal cavity increased size, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4 from Yan et al., 2019
Leydig cell nr5a1a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage II bmpr2a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage I gata4 expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
granulosa cell amh expression absent, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovary amh expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage I bmp15 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage I ddx4 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage III bmpr2b expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
granulosa cell layer nr5a1a expression spatial pattern, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovary gdf9 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
granulosa cell cyp19a1a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
male organism sterile, abnormal amhb1375/b1375 (AB) standard conditions Fig. S1 from Yan et al., 2019
ovarian follicle stage IV decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4 from Yan et al., 2019
theca cell cyp19a1a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage II gdf9 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
granulosa cell layer nr5a1a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage I increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4,  Fig. S1 from Yan et al., 2019
male organism pleuroperitoneal cavity increased size, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4 from Yan et al., 2019
ovarian follicle stage II increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4,  Fig. S1 from Yan et al., 2019
seminiferous tubule decreased size, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage III bmpr2a expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
Sertoli cell disorganized, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovary lacks all parts of type ovarian follicle stage IV, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4 from Yan et al., 2019
ovary increased size, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4 from Yan et al., 2019
ovarian follicle bmpr2b expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
male gonad development delayed, abnormal amhb1375/b1375 (AB) standard conditions Fig. 3 from Yan et al., 2019
female organism decreased fertility, abnormal amhb1375/b1375 (AB) standard conditions Fig. 2 from Yan et al., 2019
ovarian follicle stage II ddx4 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage III gata4 expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle stage III decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. S1 from Yan et al., 2019
ovary bmp15 expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
ovarian follicle gata4 expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
female organism ratio male organism, abnormal amhb1375/b1375 (AB) standard conditions Fig. 3 from Yan et al., 2019
ovarian follicle stage I bmpr2b expression decreased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
testis gsdf expression increased amount, abnormal amhb1375/b1375 (AB) standard conditions Fig. 5 from Yan et al., 2019
male organism decreased fertility, abnormal amhb1375/b1375 (AB) standard conditions Fig. 2 from Yan et al., 2019
testis increased size, abnormal amhb1375/b1375 (AB) standard conditions Fig. 4,  Fig. S1 from Yan et al., 2019
ovarian follicle stage I increased amount, abnormal amhb1375/b1375; gsdfb1279/b1279 (AB) standard conditions Fig. S1 from Yan et al., 2019
ovarian follicle stage II increased amount, abnormal amhb1375/b1375; gsdfb1279/b1279 (AB) standard conditions Fig. S1 from Yan et al., 2019
ovarian follicle stage III decreased amount, abnormal amhb1375/b1375; gsdfb1279/b1279 (AB) standard conditions Fig. S1 from Yan et al., 2019
testis increased size, abnormal amhb1375/b1375; gsdfb1279/b1279 (AB) standard conditions Fig. S1 from Yan et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.