CRISPR

CRISPR1-hhex

ID

ZDB-CRISPR-200127-6

Name

CRISPR1-hhex

Previous Names

None

Target

hhex (1)

Sequence

5' - GGAAGAACCGGGAGCTCCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zju16	hhex
zju17	hhex

Expression

Gene expression in Wild Types + CRISPR1-hhex

No data available

Phenotype

Phenotype resulting from CRISPR1-hhex

No data available

Phenotype of all Fish created by or utilizing CRISPR1-hhex

Phenotype	Fish	Conditions	Figures
digestive system duct sox9b expression absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 8 from Gao et al., 2018
liver decreased size, abnormal	hhex^zju16/zju16	standard conditions	Fig. 1 from Gao et al., 2018
pancreatic duct pdx1 expression absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
intestine left side pdx1 expression mislocalised, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
intestinal bulb cdx1b expression spatial pattern, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
exocrine pancreas prss1 expression absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 1 from Gao et al., 2018
gall bladder duct ab-2f11 labeling absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
liver fabp10a expression decreased distribution, abnormal	hhex^zju16/zju16	standard conditions	Fig. 1 from Gao et al., 2018
intestinal bulb primordium cdx1b expression spatial pattern, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
hepatic duct ab-2f11 labeling absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
extrahepatic duct ab-2f11 labeling absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
intrahepatic bile duct intestine lumen fabp2 expression mislocalised, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
gall bladder duct absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
exocrine pancreas absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 1 from Gao et al., 2018
intestinal bulb primordium hhex expression absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
liver prox1a expression decreased distribution, abnormal	hhex^zju16/zju16	standard conditions	Fig. 1 from Gao et al., 2018
liver pdx1 expression mislocalised, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6, Fig. 8 from Gao et al., 2018
liver primordium pdx1 expression mislocalised, abnormal	hhex^zju16/zju16	standard conditions	Fig. 6 from Gao et al., 2018
extrahepatic duct absent, abnormal	hhex^zju16/zju16	standard conditions	Fig. 4 from Gao et al., 2018
liver decreased size, abnormal	hhex^zju17/zju17	standard conditions	Fig. S1 from Gao et al., 2018
exocrine pancreas absent, abnormal	hhex^zju17/zju17	standard conditions	Fig. S1 from Gao et al., 2018
liver morphology, abnormal	hhex^zju16/zju16; gz15Tg	standard conditions	Fig. 3 from Gao et al., 2018
intrahepatic bile duct intestine lumen EGFP expression mislocalised, abnormal	hhex^zju16/zju16; zf3097Tg	standard conditions	Fig. 4 from Gao et al., 2018
liver EGFP expression mislocalised, abnormal	hhex^zju16/zju16; zf3097Tg	standard conditions	Fig. 4 from Gao et al., 2018
liver morphology, abnormal	hhex^zju16/zju16; zju18Tg	standard conditions	Fig. 3, Fig. S2 from Gao et al., 2018

Citations