CRISPR

CRISPR1-fgfr1b

ID

ZDB-CRISPR-200117-3

Name

CRISPR1-fgfr1b

Previous Names

None

Target

fgfr1b (1)

Sequence

5' - GGAAGCCAACTAGGACCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uc62	fgfr1b

Expression

Gene expression in Wild Types + CRISPR1-fgfr1b

No data available

Phenotype

Phenotype resulting from CRISPR1-fgfr1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-fgfr1b

Phenotype	Fish	Conditions	Figures
whole organism fgfr1b expression decreased amount, abnormal	fgfr1b^uc62/uc62	standard conditions	Fig. 2 from Leerberg et al., 2019
post-vent region decreased length, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
pharyngeal pouch alcama expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
ceratobranchial cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
post-vent region decreased length, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
pectoral fin bud fgf24 expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
whole organism fgfr1a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
Meckel's cartilage shape, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
hyosymplectic cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
whole organism fgfr1b expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud dlx2a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
whole organism fgfr4 expression amount, ameliorated	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
blood accumulation blood island, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
somite decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
blood accumulation blood island, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
pharyngeal arch dlx2a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
post-vent region decreased length, exacerbated	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
whole organism fgfr3 expression increased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
presumptive pronephric mesoderm increased distribution, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
presumptive pronephric mesoderm increased distribution, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
somite morphology, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
post-vent region kinked, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
post-vent region kinked, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
palatoquadrate cartilage shape, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud fgf24 expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud fgf8a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
pectoral fin bud fgf10a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
notochord posterior region decreased length, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 3 from Leerberg et al., 2019
pectoral fin decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
pectoral fin decreased amount, abnormal	fgfr1b^uc62/+; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
presumptive pronephric mesoderm has2 expression increased distribution, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
hyosymplectic cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
Meckel's cartilage shape, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
pectoral fin decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
neurocranium incomplete structure, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
trabecula communis split medially, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
palatoquadrate cartilage shape, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
ceratobranchial cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/+; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
ceratobranchial cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
presumptive pronephric mesoderm has2 expression increased distribution, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
ceratohyal cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
pectoral fin bud fgf24 expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
whole organism fgfr1a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
hyosymplectic cartilage absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud dlx2a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
whole organism fgfr1b expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
whole organism fgfr4 expression amount, ameliorated	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
pharyngeal arch dlx2a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
midbrain-hindbrain boundary development disrupted, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 5 from Leerberg et al., 2019
pectoral fin field tbx5a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
whole organism fgfr3 expression increased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 2 from Leerberg et al., 2019
neurocranium incomplete structure, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
trabecula communis split medially, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 7 from Leerberg et al., 2019
palatoquadrate cartilage shape, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
Meckel's cartilage displaced, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud fgf24 expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
midbrain hindbrain boundary absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 5 from Leerberg et al., 2019
apical ectodermal ridge pectoral fin bud fgf8a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
pectoral fin absent, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
pectoral fin bud fgf10a expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 4 from Leerberg et al., 2019
pharyngeal pouch alcama expression decreased amount, abnormal	fgfr1b^uc62/uc62; fgfr2^uc64/uc64; fgfr1a^uc61/uc61	standard conditions	Fig. 6 from Leerberg et al., 2019

Citations