CRISPR

CRISPR2-sox3

ID
ZDB-CRISPR-191022-1
Name
CRISPR2-sox3
Previous Names
None
Target
Sequence
5' - GGTGTCGGTGGGCCAGCGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
whu101 sox3
whu102 sox3
Expression
Gene expression in Wild Types + CRISPR2-sox3
No data available
Phenotype
Phenotype resulting from CRISPR2-sox3
No data available
Phenotype of all Fish created by or utilizing CRISPR2-sox3
Phenotype Fish Conditions Figures
ovary 17beta-estradiol decreased amount, abnormal sox3whu101/whu101 standard conditions Figure 5 with image from Hong et al., 2018
ovary boka expression increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovary cyp19a1a expression decreased amount, abnormal sox3whu101/whu101 standard conditions Figure 5 with image from Hong et al., 2018
ovary casp3a expression increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovary tspo expression increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
testis 17beta-estradiol decreased amount, abnormal sox3whu101/whu101 standard conditions Figure 5 with image from Hong et al., 2018
granulosa cell apoptotic process increased occurrence, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovarian follicle stage IV decreased amount, abnormal sox3whu101/whu101 standard conditions Figure 2 with image from Hong et al., 2018
ovary sox3 expression absent, abnormal sox3whu101/whu101 standard conditions Fig. 1 from Hong et al., 2018
ovary Ab19-casp3 labeling increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovarian follicle stage III decreased amount, abnormal sox3whu101/whu101 standard conditions Figure 2 with image from Hong et al., 2018
oocyte stage IV apoptotic process increased occurrence, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
theca cell apoptotic process increased occurrence, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovary pmaip1 expression increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
ovarian follicle development delayed, abnormal sox3whu101/whu101 standard conditions Figure 2 with image from Hong et al., 2018
ovary sox3 expression decreased amount, abnormal sox3whu101/whu101 standard conditions Fig. 1 from Hong et al., 2018
ovary capn12 expression increased amount, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
oocyte stage III apoptotic process increased occurrence, abnormal sox3whu101/whu101 standard conditions Figure 4 with image from Hong et al., 2018
female organism decreased fecundity, abnormal sox3whu101/whu101 standard conditions Figure 2 with image from Hong et al., 2018
oocyte stage III apoptotic process increased occurrence, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary cyp19a1a expression decreased amount, abnormal sox3whu102/whu102 standard conditions Figure 5 with image from Hong et al., 2018
ovary boka expression increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary casp3a expression increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary 17beta-estradiol decreased amount, abnormal sox3whu102/whu102 standard conditions Figure 5 with image from Hong et al., 2018
testis 17beta-estradiol decreased amount, abnormal sox3whu102/whu102 standard conditions Figure 5 with image from Hong et al., 2018
ovary tspo expression increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovarian follicle stage IV decreased amount, abnormal sox3whu102/whu102 standard conditions Figure 2 with image from Hong et al., 2018
granulosa cell apoptotic process increased occurrence, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary sox3 expression absent, abnormal sox3whu102/whu102 standard conditions Fig. 1 from Hong et al., 2018
ovary Ab19-casp3 labeling increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovarian follicle stage III decreased amount, abnormal sox3whu102/whu102 standard conditions Figure 2 with image from Hong et al., 2018
ovarian follicle development delayed, abnormal sox3whu102/whu102 standard conditions Figure 2 with image from Hong et al., 2018
oocyte stage IV apoptotic process increased occurrence, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
theca cell apoptotic process increased occurrence, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary pmaip1 expression increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary capn12 expression increased amount, abnormal sox3whu102/whu102 standard conditions Figure 4 with image from Hong et al., 2018
ovary sox3 expression decreased amount, abnormal sox3whu102/whu102 standard conditions Fig. 1 from Hong et al., 2018
female organism decreased fecundity, abnormal sox3whu102/whu102 standard conditions Figure 2 with image from Hong et al., 2018
Citations