CRISPR

CRISPR2-adamts9

ID
ZDB-CRISPR-190923-1
Name
CRISPR2-adamts9
Previous Names
None
Target
Sequence
5' - TAGAAGTTGCAGTATTAATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ecu8 adamts9
ecu9 adamts9
Expression
Gene expression in Wild Types + CRISPR2-adamts9
No data available
Phenotype
Phenotype resulting from CRISPR2-adamts9
No data available
Phenotype of all Fish created by or utilizing CRISPR2-adamts9
Phenotype Fish Conditions Figures
whole organism viability, abnormal adamts9ecu8/ecu8 (TU) standard conditions text only from Jansch Carter et al., 2019
ovary has extra parts of type ovarian follicle stage I, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary has fewer parts of type ovarian follicle stage IV, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary has fewer parts of type ovarian follicle stage III, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
male organism color pattern, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 6 from Jansch Carter et al., 2019
vertebral column kinked, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary decreased size, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
male organism gonad has extra parts of type ovarian follicle, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 7 from Jansch Carter et al., 2019
male organism increased amount, abnormal adamts9ecu8/ecu8 (TU) standard conditions text only from Jansch Carter et al., 2019
male organism gonad distended, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 6,  Fig. 7 from Jansch Carter et al., 2019
ovarian follicle stage IV adamts9 expression absent, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 2 from Jansch Carter et al., 2019
female organism female fertility, abnormal adamts9ecu8/ecu8 (TU) standard conditions text only from Jansch Carter et al., 2019
ovary has extra parts of type anatomical space, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
male organism gonad has fewer parts of type spermatogenic cyst, abnormal adamts9ecu8/ecu8 (TU) standard conditions Fig. 6,  Fig. 7 from Jansch Carter et al., 2019
female organism decreased amount, abnormal adamts9ecu8/ecu8 (TU) standard conditions text only from Jansch Carter et al., 2019
whole organism viability, abnormal adamts9ecu9/ecu9 (TU) standard conditions text only from Jansch Carter et al., 2019
male organism color pattern, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 6 from Jansch Carter et al., 2019
ovary has fewer parts of type ovarian follicle stage IV, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary has fewer parts of type ovarian follicle stage III, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary has extra parts of type ovarian follicle stage I, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary decreased size, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
male organism gonad has extra parts of type ovarian follicle, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 7 from Jansch Carter et al., 2019
male organism increased amount, abnormal adamts9ecu9/ecu9 (TU) standard conditions text only from Jansch Carter et al., 2019
male organism gonad distended, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 6,  Fig. 7 from Jansch Carter et al., 2019
ovarian follicle stage IV adamts9 expression absent, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 2 from Jansch Carter et al., 2019
female organism female fertility, abnormal adamts9ecu9/ecu9 (TU) standard conditions text only from Jansch Carter et al., 2019
male organism gonad has fewer parts of type spermatogenic cyst, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 6,  Fig. 7 from Jansch Carter et al., 2019
vertebral column kinked, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
ovary has extra parts of type anatomical space, abnormal adamts9ecu9/ecu9 (TU) standard conditions Fig. 5 from Jansch Carter et al., 2019
female organism decreased amount, abnormal adamts9ecu9/ecu9 (TU) standard conditions text only from Jansch Carter et al., 2019
whole organism viability, abnormal adamts9ecu8/+ (TU) standard conditions text only from Jansch Carter et al., 2019
whole organism viability, abnormal adamts9ecu9/+ (TU) standard conditions text only from Jansch Carter et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.