CRISPR

CRISPR5-mymk

ID
ZDB-CRISPR-190815-2
Name
CRISPR5-mymk
Previous Names
None
Target
Sequence
5' - GGCATTTACTCCGGCCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mb14 mymk
mb15 mymk
oz17 mymk
oz25 mymk
Expression
Gene expression in Wild Types + CRISPR5-mymk
No data available
Phenotype
Phenotype resulting from CRISPR5-mymk
No data available
Phenotype of all Fish created by or utilizing CRISPR5-mymk
Phenotype Fish Conditions Figures
fast muscle myoblast nucleate quality, abnormal mymkmb14/mb14 standard conditions Fig. 3 from Shi et al., 2018
skeletal muscle cell decreased size, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
ventral mandibular arch open, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
fast muscle myoblast mononucleate, abnormal mymkmb14/mb14 standard conditions Fig. 3 from Shi et al., 2018
whole organism decreased weight, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
skeletal muscle malformed, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
whole organism decreased size, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
fast muscle cell nucleus decreased amount, abnormal mymkmb14/mb14 standard conditions Fig. 3 from Shi et al., 2018
Fig. 6 from Si et al., 2018
fast muscle cell myoblast fusion disrupted, abnormal mymkmb14/mb14 standard conditions Fig. 3 from Shi et al., 2018
splanchnocranium morphology, abnormal mymkmb14/mb14 control Fig. 7 from Si et al., 2018
fat cell mislocalised, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
skeletal muscle cell nucleus decreased amount, abnormal mymkmb14/mb14 control Fig. 8 from Shi et al., 2018
Fig. 7 from Si et al., 2018
skeletal muscle cell decreased length, abnormal mymkmb14/mb14 standard conditions Fig. 8 from Shi et al., 2018
skeletal muscle morphology, abnormal mymkmb14/mb14 control Fig. 7 from Si et al., 2018
skeletal muscle cell decreased diameter, abnormal mymkmb14/mb14 standard conditions Fig. 8 from Shi et al., 2018
skeletal muscle has extra parts of type adipose tissue, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
cranial cartilage deformed, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
skeletal muscle fat cell increased amount, abnormal mymkmb14/mb14 control Fig. 7 from Si et al., 2018
skeletal muscle cell disorganized, abnormal mymkmb14/mb14 standard conditions Fig. 7 from Shi et al., 2018
fast muscle cell has extra parts of type fast muscle cell actin-based cell projection, abnormal mymkmb14/mb14 standard conditions Fig. 2 from Luo et al., 2022
fast muscle myoblast nucleate quality, abnormal mymkmb15/mb15 standard conditions Fig. 3 from Shi et al., 2018
fast muscle myoblast mononucleate, abnormal mymkmb15/mb15 standard conditions Fig. 3 from Shi et al., 2018
fast muscle cell nucleus decreased amount, abnormal mymkmb15/mb15 standard conditions Fig. 3 from Shi et al., 2018
fast muscle cell myoblast fusion disrupted, abnormal mymkmb15/mb15 standard conditions Fig. 3 from Shi et al., 2018
muscle cell decreased amount, abnormal mymkoz17/oz17 standard conditions Fig. 6 with image from Hromowyk et al., 2020
skeletal muscle fiber development disrupted, abnormal mymkoz17/oz17 standard conditions Fig. 6 with image from Hromowyk et al., 2020
whole organism decreased width, abnormal mymkoz17/oz17 standard conditions Fig. 5 with image from Hromowyk et al., 2020
skeletal muscle cell proliferation increased occurrence, abnormal mymkoz17/oz17 standard conditions Fig. 6 with image from Hromowyk et al., 2020
skeletal muscle satellite cell increased amount, abnormal mymkoz17/oz17 standard conditions Fig. 6 with image from Hromowyk et al., 2020
swimming decreased efficacy, abnormal mymkoz17/oz17 standard conditions Fig. 5 with image from Hromowyk et al., 2020
whole organism mymk expression absent, abnormal mymkoz17/oz17 standard conditions Fig. 2 with image from Hromowyk et al., 2020
fast muscle myoblast actin-based cell projection increased life span, abnormal mymkmb14/mb14; sw105Tg standard conditions Fig. 7 from Luo et al., 2022
fast muscle myoblast has extra parts of type fast muscle myoblast actin-based cell projection, abnormal mymkmb14/mb14; sw105Tg standard conditions Fig. 7 from Luo et al., 2022
fast muscle myoblast actin-based cell projection increased size, abnormal mymkmb14/mb14; sw105Tg standard conditions Fig. 7 from Luo et al., 2022
slow muscle cell nucleus decreased amount, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 7 with image from Hromowyk et al., 2020
fast muscle cell decreased diameter, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 4 with image from Hromowyk et al., 2020
fast muscle cell nucleus decreased amount, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 7 with image from Hromowyk et al., 2020
slow muscle cell decreased diameter, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 4 with image from Hromowyk et al., 2020
skeletal muscle fiber development disrupted, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 4 with image from Hromowyk et al., 2020
fast muscle cell cell-cell fusion decreased occurrence, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 2 with image,  Fig. 3 with image from Hromowyk et al., 2020
fast muscle cell decreased volume, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 7 with image from Hromowyk et al., 2020
fast muscle cell nucleus mononucleate, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 2 with image,  Fig. 3 with image from Hromowyk et al., 2020
slow muscle cell decreased volume, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 7 with image from Hromowyk et al., 2020
slow muscle cell misaligned with fast muscle cell, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 4 with image from Hromowyk et al., 2020
somite nucleus decreased amount, abnormal mymkoz17/oz17; fb121Tg; fb122Tg; i104Tg standard conditions Fig. 2 with image from Hromowyk et al., 2020
skeletal muscle morphology, abnormal jam2ahu3319/hu3319; mymkmb14/mb14 control Fig. 7 from Si et al., 2018
skeletal muscle fat cell increased amount, abnormal jam2ahu3319/hu3319; mymkmb14/mb14 control Fig. 7 from Si et al., 2018
skeletal muscle cell nucleus decreased amount, abnormal jam2ahu3319/hu3319; mymkmb14/mb14 control Fig. 7 from Si et al., 2018
fast muscle cell nucleus decreased amount, abnormal jam2ahu3319/hu3319; mymkmb14/mb14 control Fig. 6 from Si et al., 2018
splanchnocranium morphology, abnormal jam2ahu3319/hu3319; mymkmb14/mb14 control Fig. 7 from Si et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.