CRISPR

CRISPR2-tmem33

ID
ZDB-CRISPR-190716-4
Name
CRISPR2-tmem33
Previous Names
None
Target
Sequence
5' - TCCTCCTCCTCCTCAGGCTGGGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-tmem33
No data available
Phenotype
Phenotype resulting from CRISPR2-tmem33
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tmem33
Phenotype Fish Conditions Figures
whole organism hey2 expression decreased amount, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
whole organism notch1b expression decreased amount, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell ab9-mapk labeling decreased amount, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
Notch signaling pathway decreased occurrence, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel MAPK cascade decreased occurrence, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
whole organism dll4 expression decreased amount, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
whole organism her12 expression decreased amount, abnormal sh512Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
endothelial tip cell calcium-mediated signaling decreased occurrence, abnormal sh392Tg; sh512Tg; ubs3Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
endothelial tip cell regulation of cytosolic calcium ion concentration decreased occurrence, abnormal sh392Tg; sh512Tg; ubs3Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
endothelial tip cell regulation of store-operated calcium channel activity decreased occurrence, abnormal sh392Tg; sh512Tg; ubs3Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell GCaMP expression decreased amount, abnormal sh392Tg; sh512Tg; ubs3Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel split, abnormal sh512Tg; y1Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 3 with image from Savage et al., 2019
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal sh512Tg; y1Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 3 with image from Savage et al., 2019
intersegmental vessel decreased length, abnormal sh512Tg; y1Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 3 with image from Savage et al., 2019
cardiovascular system lacks all parts of type vascular lymphangioblast, abnormal sh512Tg; y1Tg + CRISPR1-tmem33 + CRISPR2-tmem33 standard conditions Fig. 3 with image from Savage et al., 2019
Citations