CRISPR

CRISPR1-slx4

ID

ZDB-CRISPR-190417-16

Name

CRISPR1-slx4

Previous Names

None

Target

slx4 (1)

Sequence

5' - GGCTCTGTCCCGCTCTCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg66	slx4
hg67	slx4

Expression

Gene expression in Wild Types + CRISPR1-slx4

No data available

Phenotype

Phenotype resulting from CRISPR1-slx4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-slx4

Phenotype	Fish	Conditions	Figures
response to xenobiotic stimulus process quality, abnormal	slx4^hg66/hg66	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018
female sex determination decreased occurrence, abnormal	slx4^hg66/hg66	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
whole organism decreased size, abnormal	slx4^hg66/hg66	standard conditions	Fig. 4 , Fig. S9 from Ramanagoudr-Bhojappa et al., 2018
whole organism decreased life span, abnormal	slx4^hg66/hg66	control	Fig. 3 from Ramanagoudr-Bhojappa et al., 2018
male sex determination increased occurrence, abnormal	slx4^hg66/hg66	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
whole organism morphology, abnormal	slx4^hg66/hg66	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018
male organism increased amount, abnormal	slx4^hg66/hg66	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
female organism absent, abnormal	slx4^hg66/hg66	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
whole organism decreased size, abnormal	slx4^hg67/hg67	standard conditions	Fig. S8 from Ramanagoudr-Bhojappa et al., 2018
male organism increased amount, abnormal	slx4^hg67/hg67	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
female organism absent, abnormal	slx4^hg67/hg67	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
female sex determination decreased occurrence, abnormal	slx4^hg67/hg67	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
male sex determination increased occurrence, abnormal	slx4^hg67/hg67	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
whole organism decreased size, abnormal	ercc4^hg68/+; slx4^hg66/hg66	standard conditions	Fig. S9 from Ramanagoudr-Bhojappa et al., 2018
whole organism decreased size, abnormal	ercc4^hg68/hg68; slx4^hg66/hg66	standard conditions	Fig. S9 from Ramanagoudr-Bhojappa et al., 2018
male organism increased amount, abnormal	slx4^hg67/hg67; tp53^hg91/+	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
female organism absent, abnormal	slx4^hg67/hg67; tp53^hg91/+	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
male sex determination increased occurrence, abnormal	slx4^hg67/hg67; tp53^hg91/+	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
female sex determination decreased occurrence, abnormal	slx4^hg67/hg67; tp53^hg91/+	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
male sex determination occurrence, ameliorated	slx4^hg67/hg67; tp53^hg91/hg91	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
female organism amount, ameliorated	slx4^hg67/hg67; tp53^hg91/hg91	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
male organism amount, ameliorated	slx4^hg67/hg67; tp53^hg91/hg91	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018
female sex determination occurrence, ameliorated	slx4^hg67/hg67; tp53^hg91/hg91	standard conditions	Fig. 6 from Ramanagoudr-Bhojappa et al., 2018

Citations