CRISPR

CRISPR1-trmu

ID
ZDB-CRISPR-190320-1
Name
CRISPR1-trmu
Previous Names
None
Target
Sequence
5' - GGACATCCCAGGAGGATGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3047 trmu
Expression
Gene expression in Wild Types + CRISPR1-trmu
No data available
Phenotype
Phenotype resulting from CRISPR1-trmu
No data available
Phenotype of all Fish created by or utilizing CRISPR1-trmu
Phenotype Fish Conditions Figures
whole organism tfb2m expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mt-co2 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
mitochondrial tRNA thio-modification disrupted, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
swimming decreased occurrence, abnormal trmuzf3047/zf3047 standard conditions Fig. S2 with image from Zhang et al., 2018
posterior macula succinate dehydrogenase activity decreased occurrence, abnormal trmuzf3047/zf3047 standard conditions Fig. 9 with image from Zhang et al., 2018
whole organism buoyancy, abnormal trmuzf3047/zf3047 standard conditions Fig. S2 with image from Zhang et al., 2018
neuromast hair cell decreased amount, abnormal trmuzf3047/zf3047 standard conditions Fig. 7 with image from Zhang et al., 2018
cell ATP decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
tRNA-uridine 2-sulfurtransferase activity disrupted, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism sdhb expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
aerobic respiration disrupted, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
swimming behavioral quality of a process, abnormal trmuzf3047/zf3047 standard conditions Fig. S2 with image from Zhang et al., 2018
whole organism lars2 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
anterior lateral line neuromast neuromast hair cell decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism yars2 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
posterior macula has fewer parts of type hair cell posterior macula mitochondrion, abnormal trmuzf3047/zf3047 standard conditions Fig. 9 with image from Zhang et al., 2018
macula lagena has fewer parts of type hair cell, abnormal trmuzf3047/zf3047 standard conditions Fig. 8 with image from Zhang et al., 2018
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal trmuzf3047/zf3047 standard conditions Fig. 7 with image from Zhang et al., 2018
posterior macula cytochrome-c oxidase activity decreased occurrence, abnormal trmuzf3047/zf3047 standard conditions Fig. 9 with image from Zhang et al., 2018
whole organism mt-nd6 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mt-nd1 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
macula utricle has fewer parts of type hair cell, abnormal trmuzf3047/zf3047 standard conditions Fig. 8 with image from Zhang et al., 2018
whole organism kars1 expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mt-cyb expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
macula saccule has fewer parts of type hair cell, abnormal trmuzf3047/zf3047 standard conditions Fig. 8 with image from Zhang et al., 2018
whole organism mitochondrion mt-te expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mitochondrion mt-th expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mitochondrion mt-tk expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mitochondrion mt-tm expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mitochondrion mt-tq expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
whole organism mitochondrion mt-tw expression decreased amount, abnormal trmuzf3047/zf3047 standard conditions text only from Zhang et al., 2018
Citations