CRISPR

CRISPR3-stat3

ID
ZDB-CRISPR-190318-1
Name
CRISPR3-stat3
Previous Names
None
Target
Sequence
5' - GGTCGATCTTAAGTCCTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia23 stat3
Expression
Gene expression in Wild Types + CRISPR3-stat3
No data available
Phenotype
Phenotype resulting from CRISPR3-stat3
No data available
Phenotype of all Fish created by or utilizing CRISPR3-stat3
Phenotype Fish Conditions Figures
intestinal epithelium lacks parts or has fewer parts of type intervillus pockets, abnormal stat3ia23/ia23 standard conditions Fig. 6. with image from Peron et al., 2020
whole organism dead, abnormal stat3ia23/ia23 standard conditions Fig. 6. with image from Peron et al., 2020
whole organism viability, abnormal stat3ia23/ia23 standard conditions Fig. 6. with image from Peron et al., 2020
whole organism stat1a expression increased amount, abnormal stat3ia23/ia23 standard conditions Fig. S4 from Peron et al., 2020
yolk present, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
Citations