CRISPR

CRISPR1-mdka

ID
ZDB-CRISPR-190131-2
Name
CRISPR1-mdka
Previous Names
None
Target
Sequence
5' - GGCAGCTGCGTGGCCAATAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mi5001 mdka
Expression
Gene expression in Wild Types + CRISPR1-mdka
No data available
Phenotype
Phenotype resulting from CRISPR1-mdka
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mdka
Phenotype Fish Conditions Figures
regenerating tissue retina ccnd1 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
regenerating tissue retina mdka expression absent, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 1. with image from Nagashima et al., 2019
retinal cone cell regeneration decreased occurrence, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 4. with image from Nagashima et al., 2019
retina cell population proliferation increased occurrence, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
retinal inner nuclear layer zrf-1 labeling increased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 5. with image from Nagashima et al., 2019
retina stat3 expression increased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 7. with image from Nagashima et al., 2019
Muller cell G1/S transition of mitotic cell cycle arrested, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
regenerating tissue retina ccne1 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
regenerating tissue retina stat3 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 7. with image from Nagashima et al., 2019
regenerating tissue retina stat3 expression increased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 7. with image from Nagashima et al., 2019
regenerating tissue retina ccna2 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
retina mdka expression absent, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
regenerating tissue retinal cone cell decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 4. with image from Nagashima et al., 2019
whole organism decreased length, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
retinal outer nuclear layer cell population proliferation decreased occurrence, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 2. with imageFigure 3. with image from Nagashima et al., 2019
regenerating tissue retina cdk6 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
retinal inner nuclear layer cell population proliferation decreased occurrence, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 2. with imageFigure 3. with image from Nagashima et al., 2019
whole organism decreased pigmentation, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
Muller cell cell body zrf-1 labeling increased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 5. with image from Nagashima et al., 2019
regenerating tissue retina ascl1a expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 7. with image from Nagashima et al., 2019
regenerating tissue retina cdk4 expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
retina layer formation delayed, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
regenerating tissue retina rbl2 expression increased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
eye decreased size, abnormal mdkami5001/mi5001 (AB) control Figure 1. with image from Nagashima et al., 2019
regenerating tissue retina lin28ab expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 7. with image from Nagashima et al., 2019
whole organism mdka expression absent, abnormal mdkami5001/mi5001 (AB) standard conditions Figure 1. with image from Nagashima et al., 2019
regenerating tissue retina id2a expression decreased amount, abnormal mdkami5001/mi5001 (AB) light damage: eye photoreceptor cell Figure 8. with image from Nagashima et al., 2019
regenerating tissue Muller cell GFP expression increased amount, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 5. with image from Nagashima et al., 2019
regenerating tissue Muller cell hypertrophic, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 5. with image from Nagashima et al., 2019
retinal outer nuclear layer cell population proliferation decreased occurrence, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 3. with image from Nagashima et al., 2019
retinal inner nuclear layer cell population proliferation decreased occurrence, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 3. with image from Nagashima et al., 2019
Muller cell cell population proliferation decreased occurrence, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 3. with image from Nagashima et al., 2019
Muller cell cell body displaced to regenerating tissue retinal outer plexiform layer, abnormal mdkami5001/mi5001; mi2002Tg light damage: eye photoreceptor cell Figure 5. with image from Nagashima et al., 2019
Citations