CRISPR

CRISPR3-npc1

ID
ZDB-CRISPR-190123-2
Name
CRISPR3-npc1
Previous Names
None
Target
Sequence
5' - GGCCAGCACTGTATCTGGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb334 npc1
ihb335 npc1
Expression
Gene expression in Wild Types + CRISPR3-npc1
No data available
Phenotype
Phenotype resulting from CRISPR3-npc1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-npc1
Phenotype Fish Conditions Figures
cerebellum Purkinje cell decreased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
hepatocyte morphology, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism decreased life span, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver fatty, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
liver cholesterol increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
locomotory behavior process quality, abnormal npc1ihb334/ihb334 standard conditions Fig. S Movie 1 from Lin et al., 2018
hepatocyte vacuolated, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism dead, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
spinal cord SM(d32:1) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Table S2 from Liang et al., 2021
spinal cord lysophosphatidylethanolamine 20:4 absent, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
brain phosphatidylethanolamine 33:1 absent, abnormal npc1ihb334/ihb334 (TU) fasting Table S2 from Liang et al., 2021
spleen phosphatidylinositol 38:4(1-) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spleen lysophosphatidylinositol 18:0(1-) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
brain lysophosphatidylethanolamine 20:4 absent, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
liver sphingomyelin 42:2 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spinal cord SM(d41:1) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
spinal cord lysophosphatidylethanolamine 16:0 decreased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
liver lysophosphatidylinositol 18:0(1-) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spleen sphingomyelin 43:2 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spleen Cer(d40:2) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
brain phosphatidylethanolamine 40:5 zwitterion decreased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
liver sphingomyelin 43:2 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
liver phosphatidylglycerol 44:12 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
brain Cer(d34:1) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
brain Cer(d37:1) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
spinal cord lysophosphatidylethanolamine 18:1 decreased amount, abnormal npc1ihb334/ihb334 (TU) fasting Table S2 from Liang et al., 2021
spleen sphingomyelin 42:2 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
liver Cer(d40:2) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
liver phosphatidylinositol 38:4(1-) increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spinal cord phosphatidylethanolamine 33:1 absent, abnormal npc1ihb334/ihb334 (TU) fasting Table S2 from Liang et al., 2021
intestine phosphatidylethanolamine 42:7 zwitterion decreased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
spinal cord 1-oleoyl-2-palmitoyl-sn-glycero-3-phosphoethanolamine absent, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
spleen phosphatidylglycerol 44:12 increased amount, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 5 from Liang et al., 2021
brain 1-oleoyl-2-palmitoyl-sn-glycero-3-phosphoethanolamine absent, abnormal npc1ihb334/ihb334 (TU) fasting Fig. 4 from Liang et al., 2021
whole organism decreased life span, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
locomotory behavior process quality, abnormal npc1ihb335/ihb335 standard conditions Fig. S Movie 1 from Lin et al., 2018
whole organism dead, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb335/ihb335 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.