CRISPR

CRISPR3-gdf3

ID
ZDB-CRISPR-181113-1
Name
CRISPR3-gdf3
Previous Names
None
Target
Sequence
5' - GTTTCCTCCAGGATTGGGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
fb20a gdf3
Expression
Gene expression in Wild Types + CRISPR3-gdf3
No data available
Phenotype
Phenotype resulting from CRISPR3-gdf3
No data available
Phenotype of all Fish created by or utilizing CRISPR3-gdf3
Phenotype Fish Conditions Figures
pharyngeal arch 5 tie1 expression absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
pharyngeal arch 4 tie1 expression absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
levator arcus palatini absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
hyohyoideus absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
adductor operculi absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
interhyoideus absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
pharyngeal arch 4 absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
adductor mandibulae absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
levator operculi absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
trunk mesoderm absent, abnormal gdf3fb20a/fb20a standard conditions Fig. 5 with image from Guner-Ataman et al., 2018
pharyngeal arch 3 absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
whole organism morphology, abnormal gdf3fb20a/fb20a standard conditions Fig. 5 with imageFig. S7 with image from Guner-Ataman et al., 2018
ventral intermandibularis posterior absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
bulbus arteriosus absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
anterior lateral plate mesoderm nkx2.5 expression absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
pharyngeal arch 5 absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
dilatator operculi absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
ventral intermandibularis anterior absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
cephalic mesoderm absent, abnormal gdf3fb20a/fb20a standard conditions Fig. 5 with image from Guner-Ataman et al., 2018
pharyngeal arch 3 tie1 expression absent, abnormal gdf3fb20a/fb20a standard conditions Fig. S6 with image from Guner-Ataman et al., 2018
Citations