CRISPR

CRISPR1-npsn

ID

ZDB-CRISPR-181025-1

Name

CRISPR1-npsn

Previous Names

None

Target

npsn (1)

Sequence

5' - GGAGACATCGCCTTTCCCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sm15	npsn
sm16	npsn

Expression

Gene expression in Wild Types + CRISPR1-npsn

No data available

Phenotype

Phenotype resulting from CRISPR1-npsn

No data available

Phenotype of all Fish created by or utilizing CRISPR1-npsn

Phenotype	Fish	Conditions	Figures
whole organism il1b expression increased amount, abnormal	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 , Fig. 6 from Di et al., 2017
inflammatory response increased rate, abnormal	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
whole organism npsn expression decreased amount, abnormal	npsn^sm15/sm15	control	Fig. 2 from Di et al., 2017
defense response to bacterium decreased rate, abnormal	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
whole organism tnfa expression increased amount, abnormal	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 , Fig. 6 from Di et al., 2017
neutrophil npsn expression decreased amount, abnormal	npsn^sm15/sm15	control	Fig. 2 from Di et al., 2017
whole organism cxcl8a expression increased amount, abnormal	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 , Fig. 6 from Di et al., 2017
whole organism decreased life span, exacerbated	npsn^sm15/sm15	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
whole organism il1b expression increased amount, abnormal	npsn^sm15/+	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
whole organism npsn expression decreased amount, abnormal	npsn^sm15/+	control	Fig. 2 from Di et al., 2017
whole organism cxcl8a expression increased amount, abnormal	npsn^sm15/+	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
whole organism tnfa expression increased amount, abnormal	npsn^sm15/+	bacterial treatment by injection: Escherichia coli	Fig. 4 from Di et al., 2017
neutrophil phagocytosis decreased occurrence, abnormal	npsn^sm15/sm15; i114Tg	bacterial treatment by injection: Escherichia coli	Fig. 5 from Di et al., 2017
defense response to bacterium decreased rate, abnormal	npsn^sm15/sm15; i114Tg	bacterial treatment by injection: Escherichia coli	Fig. 5 from Di et al., 2017
neutrophil chemotaxis increased rate, abnormal	npsn^sm15/sm15; i114Tg	bacterial treatment by injection: Escherichia coli	Fig. 5 from Di et al., 2017
whole organism il1b expression amount, ameliorated	npsn^sm15/sm15; sm13Tg	bacterial treatment by injection: Escherichia coli, heat exposure	Fig. 6 from Di et al., 2017
whole organism tnfa expression amount, ameliorated	npsn^sm15/sm15; sm13Tg	bacterial treatment by injection: Escherichia coli, heat exposure	Fig. 6 from Di et al., 2017
whole organism cxcl8a expression amount, ameliorated	npsn^sm15/sm15; sm13Tg	bacterial treatment by injection: Escherichia coli, heat exposure	Fig. 6 from Di et al., 2017

Citations