CRISPR

CRISPR1-cyp11c1

ID
ZDB-CRISPR-180911-1
Name
CRISPR1-cyp11c1
Previous Names
None
Target
Sequence
5' - GAGGTCAGGACTGGGGTCAAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Unable to verify this sequence by BLAST
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb284 cyp11c1
ihb285 cyp11c1
Expression
Gene expression in Wild Types + CRISPR1-cyp11c1
No data available
Phenotype
Phenotype resulting from CRISPR1-cyp11c1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cyp11c1
Phenotype Fish Conditions Figures
male organism gonad tp53 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
testis cyp11c1 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
male organism gonad cyp11a1.1 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
male organism 11-oxotestosterone decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 2 from Zhang et al., 2020
testis dmrt1 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
male organism gonad bmp15 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
testis amh expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
testis decreased size, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
male gonad development delayed, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
male organism gonad casp3a expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
male organism gonad figla expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
immature gonad present, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
male organism gonad casp9 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
testis has fewer parts of type sperm, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
fertilization disrupted, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 4 from Zhang et al., 2020
male organism gonad foxl2a expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
male gonad development delayed, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
testis Sertoli cell amh expression absent, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
testis insl3 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 8 from Zhang et al., 2020
male organism gonad casp3a expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
testis cyp11c1 expression decreased distribution, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 2 from Zhang et al., 2020
female organism cortisol decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 2 from Zhang et al., 2020
male organism gonad casp9 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
testis Leydig cell insl3 expression decreased distribution, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
ovary decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
female mating behavior process efficacy, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 4 from Zhang et al., 2020
testis has fewer parts of type sperm, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 8 from Zhang et al., 2020
oocyte stage V decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 5 from Zhang et al., 2020
male organism gonad bmp15 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
testis insl3 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
testis cyp17a1 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
oocyte stage IV meiosis I nuclear membrane disassembly disrupted, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 5 from Zhang et al., 2020
male organism gonad bmp15 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
male organism gonad tp53 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
testis absent, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
testis decreased weight, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
interrenal gland cyp11c1 expression increased distribution, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 2 from Zhang et al., 2020
male mating behavior process efficacy, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 4 from Zhang et al., 2020
male organism gonad casp9 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
oocyte stage V decreased amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by injection: cortisol Fig. 5 from Zhang et al., 2020
testis cyp11c1 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 8 from Zhang et al., 2020
testis cyp17a1 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 8 from Zhang et al., 2020
male organism gonad casp3a expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
ovary bmp15 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 7 from Zhang et al., 2020
testis decreased weight, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 8 from Zhang et al., 2020
male organism gonad foxl2a expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
male organism gonad cyp11a1.1 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
testis absent, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 7 from Zhang et al., 2020
ovary foxl2a expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 7 from Zhang et al., 2020
male organism gonad cyp11a1.1 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
male organism gonad figla expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
male organism cortisol decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 2 from Zhang et al., 2020
urogenital papilla decreased size, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 3 from Zhang et al., 2020
interrenal gland cyp11c1 expression spatial pattern, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by injection: cortisol Fig. 2 from Zhang et al., 2020
immature gonad present, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
testis decreased weight, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 8 from Zhang et al., 2020
male organism gonad foxl2a expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
testis cyp11c1 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 8 from Zhang et al., 2020
testis insl3 expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 8 from Zhang et al., 2020
testis dmrt1 expression decreased distribution, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 8 from Zhang et al., 2020
ovary figla expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 7 from Zhang et al., 2020
male organism gonad figla expression amount, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
immature gonad present, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6,  Fig. 7 from Zhang et al., 2020
whole organism fertility, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 4 from Zhang et al., 2020
oocyte stage IV meiosis I nuclear membrane disassembly disrupted, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by injection: cortisol Fig. 5 from Zhang et al., 2020
ovary decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
ovary cyp11a1.1 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 7 from Zhang et al., 2020
testis cyp17a1 expression decreased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 8 from Zhang et al., 2020
male organism gonad tp53 expression increased amount, abnormal cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: testosterone Fig. 7 from Zhang et al., 2020
testis present, ameliorated cyp11c1ihb284/ihb284 (AB) chemical treatment by environment: adrenosterone Fig. 7 from Zhang et al., 2020
male gonad development increased duration, abnormal cyp11c1ihb284/ihb284 (AB) standard conditions Fig. 6 from Zhang et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.