CRISPR

CRISPR1-nedd8

ID
ZDB-CRISPR-180718-1
Name
CRISPR1-nedd8
Previous Names
None
Target
Sequence
5' - GGAGAGAATAAAAGAGCGAGTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb1227 nedd8
Expression
Gene expression in Wild Types + CRISPR1-nedd8
No data available
Phenotype
Phenotype resulting from CRISPR1-nedd8
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nedd8
Phenotype Fish Conditions Figures
ovary decreased size, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
primary sex determination disrupted, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
oocyte stage I increased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
testis protein neddylation decreased occurrence, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 6 from Yu et al., 2020
pectoral fin female organism kdrl expression amount, ameliorated nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 3 with image from Yu et al., 2020
ovary dmrt1 expression increased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
pectoral fin breeding tubercle female organism absent, ameliorated nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 3 with image from Yu et al., 2020
oocyte stage V decreased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 2 with image from Yu et al., 2020
ovary amh expression increased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
ovary transparent, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
female organism increased length, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
oocyte degenerate, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
primordial germ cell decreased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 2 with image from Yu et al., 2020
pectoral fin female organism kdrl expression increased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 3 with image from Yu et al., 2020
ovary kitlga expression amount, ameliorated nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 4 from Yu et al., 2020
pectoral fin breeding tubercle female organism present, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 3 with image from Yu et al., 2020
fertilization decreased rate of occurrence, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
ovulation decreased occurrence, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
oocyte stage V decreased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 1 with image from Yu et al., 2020
ovary kitlga expression increased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
oocyte stage IV decreased amount, abnormal nedd8ihb1227/ihb1227 standard conditions Fig. 2 with image from Yu et al., 2020
defense response to virus disrupted, abnormal nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 8 with image from Yu et al., 2019
whole organism hemorrhagic, abnormal nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 8 with image from Yu et al., 2019
kidney mxc expression amount, ameliorated nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
whole organism swollen, abnormal nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 8 with image from Yu et al., 2019
spleen mxc expression amount, ameliorated nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
kidney ifnphi1 expression amount, ameliorated nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
spleen pkz expression amount, ameliorated nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
kidney pkz expression amount, ameliorated nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
spleen ifnphi1 expression decreased amount, abnormal nedd8ihb1227/ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 9 from Yu et al., 2019
primary sex determination disrupted, abnormal nedd8ihb1227/+ standard conditions Fig. 1 with image from Yu et al., 2020
male organism increased ratio female organism, abnormal nedd8ihb1227/+ standard conditions Fig. 1 with image from Yu et al., 2020
defense response to virus disrupted, abnormal nedd8ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 7 from Yu et al., 2019
whole organism ifnphi1 expression amount, ameliorated nedd8ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 7 from Yu et al., 2019
whole organism pkz expression amount, ameliorated nedd8ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 7 from Yu et al., 2019
whole organism mxc expression amount, ameliorated nedd8ihb1227 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 7 from Yu et al., 2019
ovary amh expression amount, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
primordial germ cell normal amount, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 standard conditions Fig. 2 with image from Yu et al., 2020
ovary kitlga expression amount, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 4 from Yu et al., 2020
ovary dmrt1 expression amount, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
ovary kitlga expression amount, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
pectoral fin breeding tubercle female organism absent, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 3 with image from Yu et al., 2020
pectoral fin breeding tubercle female organism present, ameliorated arihb1225/+; nedd8ihb1227/ihb1227 standard conditions Fig. 3 with image from Yu et al., 2020
ovary amh expression amount, ameliorated arihb1225/ihb1225; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
oocyte degenerate, exacerbated arihb1225/ihb1225; nedd8ihb1227/ihb1227 standard conditions Fig. 2 with image from Yu et al., 2020
ovary kitlga expression amount, ameliorated arihb1225/ihb1225; nedd8ihb1227/ihb1227 chemical treatment by environment: flutamide Fig. 4 from Yu et al., 2020
ovary dmrt1 expression amount, ameliorated arihb1225/ihb1225; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
ovary kitlga expression amount, ameliorated arihb1225/ihb1225; nedd8ihb1227/ihb1227 standard conditions Fig. 4 from Yu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.