CRISPR

CRISPR4-kdm6bb

ID

ZDB-CRISPR-180307-5

Name

CRISPR4-kdm6bb

Previous Names

None

Target

kdm6bb (1)

Sequence

5' - CAGGTGGAAGGCGCAGTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
b1307	kdm6bb

Expression

Gene expression in Wild Types + CRISPR4-kdm6bb

No data available

Phenotype

Phenotype resulting from CRISPR4-kdm6bb

No data available

Phenotype of all Fish created by or utilizing CRISPR4-kdm6bb

Phenotype	Fish	Conditions	Figures
whole organism kdm6bb expression decreased amount, abnormal	kdm6bb^b1307/b1307	standard conditions	Fig. 2 from Akerberg et al., 2017
anatomical structure kdm6bb expression decreased amount, abnormal	kdm6bb^b1307/b1307	standard conditions	Fig. 2 from Akerberg et al., 2017
swim bladder uninflated, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
basihyal cartilage chondrocyte decreased amount, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
heart trabecula formation decreased process quality, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 4 from Akerberg et al., 2017
cardiac ventricle decreased size, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 4 from Akerberg et al., 2017
cardiac ventricle malformed, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. Movie S1 from Akerberg et al., 2017
mouth open, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
pericardium edematous, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
cardiac ventricle shape, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 4 from Akerberg et al., 2017
whole organism viability, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
basihyal cartilage decreased length, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
whole organism decreased life span, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
head swollen, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307	standard conditions	Fig. 3 from Akerberg et al., 2017
cardiac ventricle shape, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; hsc4Tg	standard conditions	Fig. 4 from Akerberg et al., 2017
cardiac ventricle decreased size, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; hsc4Tg	standard conditions	Fig. 4 from Akerberg et al., 2017
myocardium cell population proliferation decreased process quality, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; s843Tg	standard conditions	Fig. 5 from Akerberg et al., 2017
endocardium pcna expression decreased amount, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; s843Tg	standard conditions	Fig. 5 from Akerberg et al., 2017
myocardium pcna expression decreased amount, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; s843Tg	standard conditions	Fig. 5 from Akerberg et al., 2017
endocardium cell population proliferation decreased process quality, abnormal	kdm6ba^b1308/b1308; kdm6bb^b1307/b1307; s843Tg	standard conditions	Fig. 5 from Akerberg et al., 2017

Citations