CRISPR

CRISPR1-macf1a

ID
ZDB-CRISPR-180226-1
Name
CRISPR1-macf1a
Previous Names
  • intron3 (1)
Target
Sequence
5' - GACATGGACTTCTTACATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
p1CH1 macf1a
p2CH1CH2 macf1a
Expression
Gene expression in Wild Types + CRISPR1-macf1a
No data available
Phenotype
Phenotype resulting from CRISPR1-macf1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-macf1a
Phenotype Fish Conditions Figures
oocyte stage I mitochondrial cloud increased size, abnormal macf1ap1CH1/p1CH1 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I polarity, abnormal macf1ap1CH1/p1CH1 standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I establishment of cell polarity decreased occurrence, abnormal macf1ap1CH1/p1CH1 standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I nucleus mislocalised, abnormal macf1ap1CH1/p1CH1 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I organelle disassembly decreased occurrence, abnormal macf1ap1CH1/p1CH1 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I mitochondrial cloud increased size, abnormal macf1ap2CH1CH2/p2CH1CH2 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I cell cortex ab1-buc labeling absent, abnormal macf1ap2CH1CH2/p2CH1CH2 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I nucleus mislocalised, abnormal macf1ap2CH1CH2/p2CH1CH2 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I organelle disassembly decreased occurrence, abnormal macf1ap2CH1CH2/p2CH1CH2 standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I mitochondrial cloud increased size, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I polarity, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I nucleus mislocalised, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I cell cortex ab1-buc labeling absent, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I establishment of cell polarity decreased occurrence, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I organelle disassembly decreased occurrence, abnormal macf1asa12708/+; macf1ap1CH1/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I mitochondrial cloud increased size, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I nucleus mislocalised, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I polarity, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I establishment of cell polarity decreased occurrence, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 8 with image from Escobar-Aguirre et al., 2017
oocyte stage I cell cortex ab1-buc labeling absent, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
oocyte stage I organelle disassembly decreased occurrence, abnormal macf1asa12708/+; macf1ap2CH1CH2/+ standard conditions Fig. 7 with image from Escobar-Aguirre et al., 2017
Citations