CRISPR

CRISPR1-mcoln1b

ID

ZDB-CRISPR-171023-1

Name

CRISPR1-mcoln1b

Previous Names

None

Target

mcoln1b (1)

Sequence

5' - GGCTCCGGGGACCTGAACGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg84	mcoln1b
hg85	mcoln1b

Expression

Gene expression in Wild Types + CRISPR1-mcoln1b

No data available

Phenotype

Phenotype resulting from CRISPR1-mcoln1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mcoln1b

Phenotype	Fish	Conditions	Figures
retina apoptotic process increased occurrence, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 5 from Li et al., 2017
whole organism decreased life span, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 1 from Li et al., 2017
neuromast hair cell mitochondrion broken, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. S8 from Li et al., 2017
retina homeostasis disrupted, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 5 from Li et al., 2017
brain apoptotic process increased occurrence, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 6 from Li et al., 2017
retina apoptotic body increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 5 from Li et al., 2017
neuromast hair cell vacuole increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 8 from Li et al., 2017
skeletal muscle cell microtubule cytoskeleton disorganized, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. S1 from Li et al., 2017
neuromast disorganized, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 8 from Li et al., 2017
cornea glycosaminoglycan increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. S5 from Li et al., 2017
skeletal muscle ab4-map1lc3 labeling increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 2 from Li et al., 2017
neuromast hair cell kinocilium decreased length, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 10 from Li et al., 2017
skeletal muscle cell lysosome increased size, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 3, Fig. 4 from Li et al., 2017
retinal outer nuclear layer decreased thickness, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 5 from Li et al., 2017
skeletal muscle cell mitochondrion morphology, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 4, Fig. S1 from Li et al., 2017
neuromast hair cell nucleus irregularly shaped, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 8 from Li et al., 2017
retinal inner nuclear layer cell decreased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 5 from Li et al., 2017
neuromast hair cell kinocilium decreased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 10 from Li et al., 2017
neuromast hair cell autolysosome increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 9 from Li et al., 2017
neuromast hair cell autophagy disrupted, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 9 from Li et al., 2017
skeletal muscle cell microtubule shortened, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. S1 from Li et al., 2017
neuromast neuromast hair cell position, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	chemical treatment by environment: neomycin	Fig. 8 from Li et al., 2017
skeletal muscle cell ab4-map1lc3 labeling increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 2 from Li et al., 2017
neuromast hair cell decreased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 7 from Li et al., 2017
skeletal muscle cell neuromuscular junction morphology, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 3 from Li et al., 2017
skeletal muscle autophagy disrupted, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 4 from Li et al., 2017
skeletal muscle cell autophagosome increased amount, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 2, Fig. 4 from Li et al., 2017
skeletal muscle cell autophagosome aggregated, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 2 from Li et al., 2017
eye apoptotic process increased occurrence, abnormal	mcoln1b^hg84/hg84; mcoln1a^hg82/hg82	standard conditions	Fig. 6 from Li et al., 2017

Citations