CRISPR

CRISPR1-npc1

ID

ZDB-CRISPR-170801-3

Name

CRISPR1-npc1

Previous Names

None

Target

npc1 (1)

Sequence

5' - CCATCAGAGTTTAAGGAGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg37	npc1

Expression

Gene expression in Wild Types + CRISPR1-npc1

No data available

Phenotype

Phenotype resulting from CRISPR1-npc1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-npc1

Phenotype	Fish	Conditions	Figures
whole organism decreased life span, abnormal	npc1^hg37/hg37	standard conditions	text only from Tseng et al., 2018
liver opaque, abnormal	npc1^hg37/hg37	chemical treatment by environment: beta-cyclodextrin	Fig. S2 from Tseng et al., 2018
liver npc1 expression absent, abnormal	npc1^hg37/hg37	standard conditions	Fig. 4 , Fig. S1 from Tseng et al., 2018
peripheral olfactory organ lysosome amount, ameliorated	npc1^hg37/hg37	chemical treatment by environment: beta-cyclodextrin	Fig. 8 from Tseng et al., 2018
hepatocyte structure, abnormal	npc1^hg37/hg37	standard conditions	Fig. 3 from Tseng et al., 2018
neuromast cholesterol amount, ameliorated	npc1^hg37/hg37	chemical treatment by environment: beta-cyclodextrin	Fig. 8 from Tseng et al., 2018
whole organism semi-viable, abnormal	npc1^hg37/hg37	standard conditions	text only from Tseng et al., 2018
neuromast lysosome increased amount, abnormal	npc1^hg37/hg37	control	Fig. 7 , Fig. 8 from Tseng et al., 2018
whole organism sterile, abnormal	npc1^hg37/hg37	standard conditions	text only from Tseng et al., 2018
liver low brightness, abnormal	npc1^hg37/hg37	control	Fig. 4 , Fig. S2 from Tseng et al., 2018
Purkinje cell disorganized, abnormal	npc1^hg37/hg37	standard conditions	Fig. 3 from Tseng et al., 2018
trunk cholesterol increased amount, abnormal	npc1^hg37/hg37	standard conditions	Fig. 5 from Tseng et al., 2018
yolk syncytial layer cholesterol increased amount, abnormal	npc1^hg37/hg37	control	Fig. 6 from Tseng et al., 2018
hindbrain axon structure, abnormal	npc1^hg37/hg37	standard conditions	Fig. 3 from Tseng et al., 2018
extension cholesterol increased amount, abnormal	npc1^hg37/hg37	standard conditions	Fig. 5 from Tseng et al., 2018
whole organism decreased size, abnormal	npc1^hg37/hg37	standard conditions	Fig. 2 from Tseng et al., 2018
peripheral olfactory organ lysosome increased amount, abnormal	npc1^hg37/hg37	control	Fig. 8 from Tseng et al., 2018
neuromast cholesterol increased amount, abnormal	npc1^hg37/hg37	control	Fig. 8 from Tseng et al., 2018
liver low brightness, abnormal	npc1^hg37/hg37	chemical treatment by environment: beta-cyclodextrin	Fig. S2 from Tseng et al., 2018
liver cholesterol increased amount, abnormal	npc1^hg37/hg37	standard conditions	Fig. 4 from Tseng et al., 2018
liver opaque, abnormal	npc1^hg37/hg37	control	Fig. 4 , Fig. S2 from Tseng et al., 2018
head decreased size, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
post-vent region curved dorsal, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
otolith absent, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
brain decreased size, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
post-vent region curved ventral, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
post-vent region kinked, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
blood circulation disrupted, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
post-vent region curved lateral, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021
hindbrain decreased size, abnormal	npc1^hg37/hg37 (EKW)	standard conditions	Fig. S11 from Tseng et al., 2021

Citations