CRISPR

CRISPR2-emx2

ID

ZDB-CRISPR-170601-2

Name

CRISPR2-emx2

Previous Names

None

Target

emx2 (1)

Sequence

5' - GGCTTTCACTCCAGCGGCAGGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
idc5	emx2

Expression

Gene expression in Wild Types + CRISPR2-emx2

No data available

Phenotype

Phenotype resulting from CRISPR2-emx2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-emx2

Phenotype	Fish	Conditions	Figures
neuromast stereocilium bundle bilateral symmetry, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
macula utricle vestibular receptor cell stereocilium organization decreased process quality, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 S1 from Jiang et al., 2017
macula utricle stereocilium bundle orientation macula utricle, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 S1 from Jiang et al., 2017
posterior lateral line posterior lateral line neuromast development decreased process quality, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
posterior lateral line neuromast hair cell development decreased process quality, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
posterior lateral line neuromast neuromast hair cell emx2 expression absent, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
neuromast stereocilium bundle unidirectional, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
neuromast hair cell stereocilium bundle orientation neuromast, abnormal	emx2^idc5/idc5	standard conditions	Fig. 10 from Jiang et al., 2017
posterior lateral line neuromast stereocilium bundle orientation posterior lateral line neuromast, abnormal	emx2^idc5/idc5	standard conditions	Fig. 8 from Ji et al., 2018
posterior lateral line neuromast synapse assembly decreased occurrence, abnormal	emx2^idc5/idc5	control	Fig. 5 from Ji et al., 2018
lateral crista stereocilium bundle orientation lateral crista, abnormal	emx2^idc5/idc5; vo8Tg	standard conditions	Fig. 10 S1 from Jiang et al., 2017
lateral crista vestibular receptor cell stereocilium organization decreased process quality, abnormal	emx2^idc5/idc5; vo8Tg	standard conditions	Fig. 10 S1 from Jiang et al., 2017
neuromast hair cell mislocalised, abnormal	emx2^idc5/idc5; vo8Tg	standard conditions	Figure 4 from Ohta et al., 2020
neuromast hair cell morphogenesis disrupted, abnormal	emx2^idc5/idc5; vo8Tg	standard conditions	Figure 4 from Ohta et al., 2020
afferent neuron innervation process quality, abnormal	emx2^idc5/idc5; cntnap2a^nkhgn39dEt	control	Fig. 2 , Fig. 3 from Ji et al., 2018
afferent neuron innervation increased occurrence, abnormal	emx2^idc5/idc5; cntnap2a^nkhgn39dEt	control	Fig. 3 from Ji et al., 2018
posterior lateral line neuromast afferent neuron branchiness, abnormal	emx2^idc5/idc5; cntnap2a^nkhgn39dEt	control	Fig. 2 from Ji et al., 2018
posterior lateral line neuromast stereocilium bundle orientation posterior lateral line neuromast, abnormal	emx2^idc5/idc5; vangl2^m209/m209	standard conditions	Fig. 8 from Ji et al., 2018

Citations