CRISPR

CRISPR1-gpr183a

ID
ZDB-CRISPR-170331-1
Name
CRISPR1-gpr183a
Previous Names
None
Target
Sequence
5' - GGAGGGTTTATGCAAGGCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ioz9 gpr183a
Expression
Gene expression in Wild Types + CRISPR1-gpr183a
No data available
Phenotype
Phenotype resulting from CRISPR1-gpr183a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gpr183a
Phenotype Fish Conditions Figures
head kidney cell decreased amount, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 2 with image from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression amount, ameliorated gpr183aioz9/ioz9 (AB/TU) chemical treatment: LY-411575 Fig. 3 with image from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression increased amount, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 3 with image from Zhang et al., 2015
ventral wall of dorsal aorta gpr183a expression absent, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. S3 with image from Zhang et al., 2015
whole organism hey2 expression increased amount, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 3 with image from Zhang et al., 2015
ventral wall of dorsal aorta myb expression decreased amount, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 2 with imageFig. 3 with image from Zhang et al., 2015
definitive hemopoiesis decreased occurrence, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 2 with image from Zhang et al., 2015
ventral wall of dorsal aorta myb expression amount, ameliorated gpr183aioz9/ioz9 (AB/TU) chemical treatment: LY-411575 Fig. 3 with image from Zhang et al., 2015
thymus rag1 expression decreased amount, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 2 with image from Zhang et al., 2015
head kidney decreased size, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 2 with image from Zhang et al., 2015
ventral wall of dorsal aorta Notch signaling pathway increased occurrence, abnormal gpr183aioz9/ioz9 (AB/TU) control Fig. 3 with image from Zhang et al., 2015
whole organism hey2 expression amount, ameliorated gpr183aioz9/ioz9 (AB/TU) chemical treatment: LY-411575 Fig. 3 with image from Zhang et al., 2015
ventral wall of dorsal aorta mCherry expression decreased amount, abnormal gpr183aioz9/ioz9; ioz1Tg; s896Tg control Fig. 2 with image from Zhang et al., 2015
ventral wall of dorsal aorta GFP expression decreased amount, abnormal gpr183aioz9/ioz9; ioz1Tg; s896Tg control Fig. 2 with image from Zhang et al., 2015
ventral wall of dorsal aorta angioblastic mesenchymal cell decreased amount, abnormal gpr183aioz9/ioz9; ioz1Tg; s896Tg control Fig. 2 with image from Zhang et al., 2015
angioblastic mesenchymal cell mCherry expression decreased amount, abnormal gpr183aioz9/ioz9; ioz1Tg; s896Tg control Fig. 2 with image from Zhang et al., 2015
angioblastic mesenchymal cell GFP expression decreased amount, abnormal gpr183aioz9/ioz9; ioz1Tg; s896Tg control Fig. 2 with image from Zhang et al., 2015
Citations