CRISPR

CRISPR1-nr3c1

ID
ZDB-CRISPR-170216-1
Name
CRISPR1-nr3c1
Previous Names
None
Target
Sequence
5' - ACAGCTGTCGTCGGTCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia30 nr3c1
Expression
Gene expression in Wild Types + CRISPR1-nr3c1
No data available
Phenotype
Phenotype resulting from CRISPR1-nr3c1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nr3c1
Phenotype Fish Conditions Figures
whole organism ddit4 expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism epas1a expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 1 with image from Dinarello et al., 2022
whole organism hif1al expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism ucp3 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 3 with image from Dinarello et al., 2022
whole organism crhb expression increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism ulk2 expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism nr3c2 expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 2 with image from Dinarello et al., 2022
whole organism ucp3 expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 3 with image from Dinarello et al., 2022
whole organism pomca expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
trabecular layer of ventricle decreased object quality, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism hsd11b2 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 5 from Facchinello et al., 2017
whole organism slc25a25a expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 3 with image from Dinarello et al., 2022
whole organism crhb expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism epas1a expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 1 with image from Dinarello et al., 2022
whole organism socs3a expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
heart structure, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism klf9 expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 1 with image from Dinarello et al., 2022
whole organism pomca expression increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism nr3c1 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 1 with image from Dinarello et al., 2022
Fig. S1 with image from Facchinello et al., 2017
intestinal bulb epithelium decreased thickness, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism viability, abnormal nr3c1ia30/ia30 standard conditions Fig. 1 from Facchinello et al., 2017
whole organism star expression increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 5 from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 4 from Facchinello et al., 2017
whole organism ucp2 expression amount, ameliorated nr3c1ia30/ia30 chemical treatment by environment: dexamethasone Figure 1 with image from Dinarello et al., 2022
subcutaneous fat increased amount, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism ucp2 expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 1 with image from Dinarello et al., 2022
pancreas decreased size, abnormal nr3c1ia30/ia30 standard conditions Fig. 2 with image from Facchinello et al., 2017
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism slc25a25a expression decreased amount, abnormal nr3c1ia30/ia30 standard conditions Figure 3 with image from Dinarello et al., 2022
whole organism cortisol increased amount, abnormal nr3c1ia30/ia30 mechanical stress Fig. 4 from Facchinello et al., 2017
whole organism EGFP expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism EGFP expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism foxo3b expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg chemical treatment: dexamethasone Fig. 3 with image from Facchinello et al., 2017
whole organism foxo3b expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg control Fig. 3 with image from Facchinello et al., 2017
whole organism fkbp5 expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg control Fig. 3 with image from Facchinello et al., 2017
whole organism EGFP expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg control Fig. 3 with image from Facchinello et al., 2017
whole organism EGFP expression decreased amount, abnormal nr3c1ia30/ia30; ia20Tg control Fig. 3 with image from Facchinello et al., 2017
whole organism EGFP expression amount, ameliorated nr3c1ia30/ia30; ia21Tg chemical treatment: dexamethasone Fig. S3 with image from Vettori et al., 2017
intestine EGFP expression decreased amount, abnormal nr3c1ia30/ia30; ia28Tg standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/+; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/+; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/ia30; stat3ia23/+ standard conditions Figure 4 with image from Dinarello et al., 2022
yolk present, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
head decreased size, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
whole organism viability, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
pericardium edematous, abnormal nr3c1ia30/ia30; stat3ia23/ia23 standard conditions Figure 4 with image from Dinarello et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.