CRISPR

CRISPR1-efnb1

ID
ZDB-CRISPR-161220-2
Name
CRISPR1-efnb1
Previous Names
None
Target
Sequence
5' - GGACATTATCTGCCCCAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nim26 efnb1
Expression
Gene expression in Wild Types + CRISPR1-efnb1
No data available
Phenotype
Phenotype resulting from CRISPR1-efnb1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-efnb1
Phenotype Fish Conditions Figures
hepatocyte cell migration process quality, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
liver primordium malformed, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
common bile duct disconnected, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
liver efnb1 expression absent, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
common bile duct duct epithelial cell morphology, abnormal efnb1nim26/nim26 standard conditions Fig. 3 with image from Thestrup et al., 2019
common bile duct decreased length, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
gall bladder decreased size, abnormal efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct branched, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
hepatoblast mislocalised, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
common bile duct epithelial tube morphogenesis disrupted, abnormal efnb1nim26/nim26 standard conditions Fig. 3 with imageFig. 7 with image from Thestrup et al., 2019
common bile duct morphology, abnormal efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct lumen structure, abnormal efnb1nim26/nim26 standard conditions Fig. 3 with image from Thestrup et al., 2019
digestive system duct morphology, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
extrapancreatic duct morphology, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
cystic duct increased size, abnormal efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
extrahepatic duct absent, abnormal efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
hepatoblast efnb1 expression absent, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
embryonic liver development process quality, abnormal efnb1nim26/nim26 standard conditions Fig. S2 with image from Cayuso et al., 2016
extrahepatic duct increased width, abnormal efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
common bile duct disconnected, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
extrapancreatic duct morphology, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct lumen structure, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
hepatopancreatic ampulla increased size, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
cystic duct absent, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct epithelial tube morphogenesis disrupted, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct decreased length, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
extrahepatic duct absent, abnormal efnb2ahu3393/hu3393; efnb1nim26/nim26 standard conditions Fig. 7 with image from Thestrup et al., 2019
common bile duct cystic, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
common bile duct branched, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
hepatopancreatic ampulla bifurcated, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
extrapancreatic duct branched, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
common bile duct decreased length, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
digestive system duct decreased size, abnormal ephb3bnim27/nim27; efnb1nim26/nim26 standard conditions Fig. 2 with image from Thestrup et al., 2019
Citations