CRISPR

CRISPR1-bloc1s2

ID

ZDB-CRISPR-161219-1

Name

CRISPR1-bloc1s2

Previous Names

None

Target

bloc1s2 (1)

Sequence

5' - AATGGCCGCTACGGGGGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ioz8	bloc1s2

Expression

Gene expression in Wild Types + CRISPR1-bloc1s2

No data available

Phenotype

Phenotype resulting from CRISPR1-bloc1s2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-bloc1s2

Phenotype	Fish	Conditions	Figures
lymphoid progenitor cell differentiation increased occurrence, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
whole organism bloc1s2 expression decreased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
thymus lymphoid progenitor cell rag1 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
trunk hey2 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	control	Fig. 5 S3 from Zhou et al., 2016
trunk runx1 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	control	Fig. 5 S3 from Zhou et al., 2016
neuron bloc1s2 expression decreased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 , Fig. 5 S3 from Zhou et al., 2016
trunk runx1 expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
erythroid lineage cell gata1a expression decreased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
erythroid lineage cell myeloid progenitor cell differentiation decreased occurrence, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal	bloc1s2^ioz8/ioz8	control	Fig. 5 S3 from Zhou et al., 2016
myeloid progenitor cell differentiation decreased occurrence, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
myeloid cell spi1b expression decreased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell myb expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
trunk myb expression increased amount, abnormal	bloc1s2^ioz8/ioz8	control	Fig. 5 S3 from Zhou et al., 2016
whole organism runx1 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
whole organism myb expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
trunk hey2 expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
endothelial cell bloc1s2 expression decreased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 from Zhou et al., 2016
trunk efnb2a expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
trunk efnb2a expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 S3 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 , Fig. 5 S3 from Zhou et al., 2016
dorsal aorta hey2 expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 S3 from Zhou et al., 2016
trunk myb expression amount, ameliorated	bloc1s2^ioz8/ioz8	chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor	Fig. 5 S3 from Zhou et al., 2016
dorsal aorta efnb2a expression increased amount, abnormal	bloc1s2^ioz8/ioz8	standard conditions	Fig. 5 S3 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal	bloc1s2^ioz8/ioz8; jh11Tg; y1Tg	standard conditions	Fig. 5 S3 from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal	bloc1s2^ioz8/ioz8; s896Tg; zf169Tg	standard conditions	Fig. 5 from Zhou et al., 2016

Citations