CRISPR

CRISPR1-mpv17

ID

ZDB-CRISPR-161201-2

Name

CRISPR1-mpv17

Previous Names

None

Target

mpv17 (1)

Sequence

5' - GGGTCTTTGGAGATCTTATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cig10a	mpv17
cig10b	mpv17

Expression

Gene expression in Wild Types + CRISPR1-mpv17

No data available

Phenotype

Phenotype resulting from CRISPR1-mpv17

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mpv17

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 2 from Bian et al., 2021
whole organism fgf10a expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
fast muscle cell disorganized, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism prox1a expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
fast muscle cell ab-f310 labeling spatial pattern, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism hhex expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
eye iridophore absence of anatomical entity, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 1 from Bian et al., 2021
skeletal muscle mitochondrion decreased diameter, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 6 from Bian et al., 2021
skeletal muscle mitochondrion decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 6 from Bian et al., 2021
whole organism tfa expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
liver anatomical structure quality, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
trunk skeletal muscle decreased mass, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
trunk skeletal muscle cell increased distance trunk skeletal muscle cell, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism dgat2 expression increased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
whole organism ATP decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
slow muscle cell anatomical structure quality, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
slow muscle cell ab-f59 labeling spatial pattern, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism mstnb expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism glucose decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
whole organism fn1a expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism fgf10b expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
trunk melanocyte decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 1 from Bian et al., 2021
whole organism triglyceride decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
somite myod1 expression decreased distribution, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism myod1 expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism bmp2b expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism rbp4 expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism mstna expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
skeletal muscle mitochondrial inner membrane decreased area, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 6 from Bian et al., 2021
trunk skeletal muscle cell loose, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism myf5 expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
trunk iridophore absence of anatomical entity, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 1 from Bian et al., 2021
trunk melanocyte decreased distribution, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 1 from Bian et al., 2021
skeletal muscle mitochondrial crista broken, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 6 from Bian et al., 2021
fast muscle cell anatomical structure quality, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism wnt2bb expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism semi-viable, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 2 from Bian et al., 2021
liver tfa expression decreased distribution, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism mgll expression increased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
liver morphology, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
slow muscle cell disorganized, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 3 from Bian et al., 2021
whole organism decreased weight, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 4 from Bian et al., 2021
whole organism ppp1r12a expression decreased amount, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 5 from Bian et al., 2021
whole organism viability, abnormal	mpv17^{cig10b/cig10b}	standard conditions	Fig. 2 from Bian et al., 2021

Citations